TkA02G253480 | RubberDandelionOmics

Gene overview

TkA02G253480

Reference: TK1151 Chr: Chr02 Coordinates: 64869501-64878508 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1077 bp · TkA02G253480|TK1151|cDNA

ATGAACCGCTACTGCACGCACGCCACGGCTACTGATCTCAATCGACGCCTCCATCCCCTCGCGATTCCACCTCCGGCTGTTTGGCTGTGTGATTTTATACCGATAACACGGGGTGTTTGGCTGTGTGATTTTATACCGACTTCTTCCTCCTCTGCTGCCATTCTCAAAACAGCGAAACGGATTCAACGAGAGACCACATCAGGTAATCAGGTTCCACACGCATCTCGCACCACCGCTACTGCACGCACGCCTTCATTTTA...

CDS

Download CDS FASTA

1077 bp · TkA02G253480|TK1151|CDS

ATGAACCGCTACTGCACGCACGCCACGGCTACTGATCTCAATCGACGCCTCCATCCCCTCGCGATTCCACCTCCGGCTGTTTGGCTGTGTGATTTTATACCGATAACACGGGGTGTTTGGCTGTGTGATTTTATACCGACTTCTTCCTCCTCTGCTGCCATTCTCAAAACAGCGAAACGGATTCAACGAGAGACCACATCAGGTAATCAGGTTCCACACGCATCTCGCACCACCGCTACTGCACGCACGCCTTCATTTTA...

Protein

Download Protein FASTA

358 aa · TkA02G253480|TK1151|PROTEIN

MNRYCTHATATDLNRRLHPLAIPPPAVWLCDFIPITRGVWLCDFIPTSSSSAAILKTAKRIQRETTSGNQVPHASRTTATARTPSFYSKKEDEEKAREKELNELFKIAVVQSKVPPGRFCIDFDLLCAKGFKCKFSHDLNVQRKGEKIDIFSDKRDALESISFIKKQDKPVQFQVVNVGLPVFSIHGNHDDPAVVDNLSAVDILSACNLVNYFGKMVLGGSGVGGSRTKAGAIRCKKDFMTKSTLGQQQMRFMVPVWSCA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G253480`
TK1151 ID	TkA02G253480
OH-1004 ID	LXL04_016981
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.900
Protein coverage (%)	TK1151 98.324 / OH-1004 90.933 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G253480

Location Chr02:64869501-64878508 (+)

Description Similar to At2g20280: Zinc finger CCCH domain-containing protein 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g54260`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`At2g20280`	Zinc finger CCCH domain-containing protein 21.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q25AA3`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`Os04g0635900`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`Os01g0834700`	Zinc finger CCCH domain-containing protein 11.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016981 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0002181 cytoplasmic translation Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process

GO:0042138 meiotic DNA double-strand break formation Biological Process

GO:0097552 mitochondrial double-strand break repair via homologous recombination Biological Process

GO:0000785 chromatin Cellular Component

GO:0000791 euchromatin Cellular Component

GO:0000795 synaptonemal complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G20280

ath:AT5G54260

dosa:Os01g0834700

dosa:Os04g0635900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.392

Rank 1 · TkA02G253480 · TK1151

Nucleus0.361

Rank 2 · TkA02G253480 · TK1151

Mitochondrion0.149

Rank 3 · TkA02G253480 · TK1151

Cell membrane0.111

Rank 4 · TkA02G253480 · TK1151

Endoplasmic reticulum0.094

Rank 5 · TkA02G253480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16131Torus118-151 aa

PF25585zf-CCCH_DUS3L127-140 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G253480	`PF16131`	Torus	118	151	0.39	12.0
TkA02G253480	`PF25585`	zf-CCCH_DUS3L	127	140	0.0029	18.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XGM2`	Arabidopsis thaliana	sp\|Q9XGM2\|MRE11_ARATH Double-strand break repair protein MRE11	51.200%	Swiss-Prot	Low
`Q9SK74`	Arabidopsis thaliana	sp\|Q9SK74\|C3H21_ARATH Zinc finger CCCH domain-containing protein 21	66.200%	Swiss-Prot	Low
`Q25AA3`	Oryza sativa subsp. indica	sp\|Q25AA3\|MRE11_ORYSI Double-strand break repair protein MRE11	47.200%	Swiss-Prot	Low
`Q7XQR9`	Oryza sativa subsp. japonica	sp\|Q7XQR9\|MRE11_ORYSJ Double-strand break repair protein MRE11	47.200%	Swiss-Prot	Low
`Q0JHZ2`	Oryza sativa subsp. japonica	sp\|Q0JHZ2\|C3H11_ORYSJ Zinc finger CCCH domain-containing protein 11	69.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card