TkA02G173270 | RubberDandelionOmics

Gene overview

TkA02G173270

Reference: TK1151 Chr: Chr02 Coordinates: 44523014-44525113 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1452 bp · TkA02G173270|TK1151|cDNA

ATGGCAAGAATATCTGAACTTGGATATGGTTGTACTGGCGCTGAATTGAAGATTAGGATTTTGCGCAAATGGATTCATCACTACCGTCAAACCGAAACATGGTTCCTTGCTGTGGACCAACATGGCGACGCAGTTCAGATACTTGGCAAGAAGCCAAACCAACATTTACTCGAATCAAAGCTTCATGTTCAACGGTGTTATGCAATCGAAGACTACACATGCACACAAACTCGCAACTACCTAAAAACTATTTCCAATCC...

CDS

Download CDS FASTA

1452 bp · TkA02G173270|TK1151|CDS

ATGGCAAGAATATCTGAACTTGGATATGGTTGTACTGGCGCTGAATTGAAGATTAGGATTTTGCGCAAATGGATTCATCACTACCGTCAAACCGAAACATGGTTCCTTGCTGTGGACCAACATGGCGACGCAGTTCAGATACTTGGCAAGAAGCCAAACCAACATTTACTCGAATCAAAGCTTCATGTTCAACGGTGTTATGCAATCGAAGACTACACATGCACACAAACTCGCAACTACCTAAAAACTATTTCCAATCC...

Protein

Download Protein FASTA

483 aa · TkA02G173270|TK1151|PROTEIN

MARISELGYGCTGAELKIRILRKWIHHYRQTETWFLAVDQHGDAVQILGKKPNQHLLESKLHVQRCYAIEDYTCTQTRNYLKTISNPIHLNLGLASKIKEIEDSVIYPRHWFQFDSIERLQQPANENPDLTDVIGSFKEIRTLHKDDGELFVKLALIHESGNELNITLWNECINSREKFDSDFLNTTATNTIFALTGLKIKDYGGQPSFNSTAATHVYRNPAVPETESLVKRLENNALLPSMILYTPITLLELSNLSYSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G173270`
TK1151 ID	TkA02G173270
OH-1004 ID	LXL04_012676
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.700
Protein coverage (%)	TK1151 83.437 / OH-1004 39.744 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G173270`
Location	Chr02:44523014-44525113 (-)
Description	Similar to pif1: ATP-dependent DNA helicase PIF1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012676` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0001117 protein-DNA-RNA complex disassembly Biological Process GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0042645 mitochondrial nucleoid Cellular Component GO:0000287 magnesium ion binding Molecular Function
KEGG gene cross-reference	hsa:80119 mmu:208084 rno:367645 xla:734585 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.916

Rank 1 · TkA02G173270 · TK1151

Cytoplasm0.169

Rank 2 · TkA02G173270 · TK1151

Cell membrane0.020

Rank 3 · TkA02G173270 · TK1151

Mitochondrion0.017

Rank 4 · TkA02G173270 · TK1151

Extracellular0.012

Rank 5 · TkA02G173270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16900REPA_OB_2124-211 aa

PF08646Rep_fac-A_C266-386 aa

PF06677Auto_anti-p27284-306 aa

PF16099RMI1_C313-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G173270	`PF16900`	REPA_OB_2	124	211	6.7e-06	26.7
TkA02G173270	`PF08646`	Rep_fac-A_C	266	386	0.00029	21.4
TkA02G173270	`PF06677`	Auto_anti-p27	284	306	0.078	13.8
TkA02G173270	`PF16099`	RMI1_C	313	348	0.085	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card