TkA02G091290 | RubberDandelionOmics

Gene overview

TkA02G091290

Reference: TK1151 Chr: Chr02 Coordinates: 23764879-23767659 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1314 bp · TkA02G091290|TK1151|cDNA

CAAACCCTTTTTCACTTCACAAACAAAAACGACGCCAGAAAGAAACCCTAGACAGAAAGCAAACATGGCGGAACAGCAACAACAACAGCAAGACGGCTACCAAATTGACATAGGGAATCTAATGGCGTACGATCCTCAACACCAGTTCCAATCTATCCCCGAGAAAAGGGAGGATCTTGTAAAGGAGTGCATAGCACATGCTACAAAGTTAATTCAAGCAGTTGCAGATACTCTCTTTAGCTTGCCTTCAACAGAAGATG...

CDS

Download CDS FASTA

1017 bp · TkA02G091290|TK1151|CDS

ATGGCGGAACAGCAACAACAACAGCAAGACGGCTACCAAATTGACATAGGGAATCTAATGGCGTACGATCCTCAACACCAGTTCCAATCTATCCCCGAGAAAAGGGAGGATCTTGTAAAGGAGTGCATAGCACATGCTACAAAGTTAATTCAAGCAGTTGCAGATACTCTCTTTAGCTTGCCTTCAACAGAAGATGCATCTGGACCCATTGTTCCATTACCTCCACCAATTACAAAATTACCTAGAGAAAAACCTCTTCC...

Protein

Download Protein FASTA

338 aa · TkA02G091290|TK1151|PROTEIN

MAEQQQQQQDGYQIDIGNLMAYDPQHQFQSIPEKREDLVKECIAHATKLIQAVADTLFSLPSTEDASGPIVPLPPPITKLPREKPLPKPAPPTKWEVFAKKKGIQNRKKDKLVFDEQTSSWKRRYGYDRVNDDNDIPIIEAKMTDEVGVDPFAKRRSEKKQRVDKQEKNRLHNLKEASKVGALPSHVQLAATALPITGTQAQPRKVSKDELQNVAGMAATSTASGGKFDKKLAGEKAPKHDKKYRKFLPVVEGNGAGSLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G091290`
TK1151 ID	TkA02G091290
OH-1004 ID	LXL04_016940
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G091290

Location Chr02:23764879-23767659 (-)

Description Similar to At2g37990: Ribosome biogenesis regulatory protein homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37990`	Involved in ribosome biogenesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016940 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000027 ribosomal large subunit assembly Biological Process

GO:0000447 endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0007080 mitotic metaphase chromosome alignment Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:1902570 protein localization to nucleolus Biological Process

GO:0000794 condensed nuclear chromosome Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0030687 preribosome, large subunit precursor Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G37990

bta:510956

hsa:23212

mmu:59014

rno:297784

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.963

Rank 1 · TkA02G091290 · TK1151

Cytoplasm0.122

Rank 2 · TkA02G091290 · TK1151

Mitochondrion0.017

Rank 3 · TkA02G091290 · TK1151

Cell membrane0.009

Rank 4 · TkA02G091290 · TK1151

Extracellular0.007

Rank 5 · TkA02G091290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04939RRS112-174 aa

PF04939RRS1288-288 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G091290	`PF04939`	RRS1	12	174	1.8e-53	181.5
TkA02G091290	`PF04939`	RRS1	288	288	1.8e-53	181.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SH88`	Arabidopsis thaliana	sp\|Q9SH88\|RRS1_ARATH Ribosome biogenesis regulatory protein homolog	63.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card