RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G086300
Reference: TK1151 Chr: Chr02 Coordinates: 22432769-22436752 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1209 bp · TkA02G086300|TK1151|cDNA

CAAGATCATTAATTGATGTTGAATGTTTCTTGATGCCATTATTGATGAATTGAGTATGACATTTGTCAACATCATTCTGAATTTTCGTCTTATGGTCTCCATTACTACTACTATTATTATTTTTTTAATTTGTGTGGTTGGGAATTGGAACAAAACAGATATTTGGCAGAATTACTTGCAGAGAGGCAAAAGTTGGCACCATTTATGCAAGTCATGCCAATATGCAGCAGGCTCCTAAATCAAGAGATCATGAAAACATC...

CDS

Download CDS FASTA

891 bp · TkA02G086300|TK1151|CDS

ATGGAGAATAGAATACCACCAGGAAGTTACTTCCAGTACTCTCCTACTGGAGTTCATAGTTCACTCCAGAGGTCTTCGTCTCCCTCAGATCGTGAAAGATATTTGGCAGAATTACTTGCAGAGAGGCAAAAGTTGGCACCATTTATGCAAGTCATGCCAATATGCAGCAGGCTCCTAAATCAAGAGATCATGAAAACATCGGGAATGGTGTCGAATCATAATTTTGTGGATCATGAAAGGATGTTGCGTGACAGGTCATC...

Protein

Download Protein FASTA

296 aa · TkA02G086300|TK1151|PROTEIN

MENRIPPGSYFQYSPTGVHSSLQRSSSPSDRERYLAELLAERQKLAPFMQVMPICSRLLNQEIMKTSGMVSNHNFVDHERMLRDRSSFRSFNQKPNRGPMDVEAWPPMQPEDNRLLQRMASFQASAMGWPASPGMATTPTVIKKVIRLDVPVEKFPNYNFVGRILGPRGNSLKRIEAMTECRIYIRGRGSVKDSVKEEKLKDKPGYEHLNDPLHLLLEAEFPEDMIDSRLDHAVALLENLLKPVDESMDTYKKHQLRELA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G086300
TK1151 IDTkA02G086300
OH-1004 IDLXL04_016974
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G086300
LocationChr02:22432769-22436752 (-)
DescriptionSimilar to At1g09660/At1g09670: KH domain-containing protein At1g09660/At1g09670
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
UniProt: Q8GWR3 KH domain-containing protein At1g09660/At1g09670. No verified direct reference in this release
At3g08620 KH domain-containing protein At3g08620. No verified direct reference in this release
At2g38610 KH domain-containing protein At2g38610. No verified direct reference in this release
At4g26480 KH domain-containing protein At4g26480. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0815700 Involved in flowering time control.
SPIN1, a K homology domain protein negatively regulated and ubiquitinated by the E3 ubiquitin ligase SPL11, is involved in flowering time control in rice.2008 · DOI: 10.1105/tpc.108.058610
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_016974 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009737 response to abscisic acid Biological Process
GO:0009751 response to salicylic acid Biological Process
GO:0009908 flower development Biological Process
GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process
GO:0048577 negative regulation of short-day photoperiodism, flowering Biological Process
GO:0048579 negative regulation of long-day photoperiodism, flowering Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0003677 DNA binding Molecular Function
GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference
ath:AT1G09660
ath:AT2G38610
ath:AT3G08620
ath:AT4G26480
dosa:Os03g0815700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.861
Rank 1 · TkA02G086300 · TK1151
Cytoplasm0.279
Rank 2 · TkA02G086300 · TK1151
Cell membrane0.022
Rank 3 · TkA02G086300 · TK1151
Mitochondrion0.022
Rank 4 · TkA02G086300 · TK1151
Endoplasmic reticulum0.012
Rank 5 · TkA02G086300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26575HHO5_N20-64 aa
PF16544STAR_dimer30-79 aa
PF16274Qua133-67 aa
PF21800KH_KRR1_2nd62-75 aa
PF22675KH-I_KHDC4-BBP155-242 aa
PF00013KH_1159-188 aa
PF21800KH_KRR1_2nd161-188 aa
PF22891KH_PNO1_2nd161-187 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G086300PF26575HHO5_N20640.002318.7
TkA02G086300PF16544STAR_dimer30792.9e-1349.8
TkA02G086300PF16274Qua133670.05814.1
TkA02G086300PF21800KH_KRR1_2nd62750.01316.2
TkA02G086300PF22675KH-I_KHDC4-BBP1552429.4e-2174.2
TkA02G086300PF00013KH_11591888.9e-0522.9
TkA02G086300PF21800KH_KRR1_2nd1611880.01316.2
TkA02G086300PF22891KH_PNO1_2nd1611870.0614.0
TkA02G086300PF16274Qua12242380.05814.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GWR3Arabidopsis thalianasp|Q8GWR3|QKIL5_ARATH KH domain-containing protein At1g09660/At1g0967063.800%Swiss-ProtHigh
Q8GYR4Arabidopsis thalianasp|Q8GYR4|QKIL4_ARATH KH domain-containing protein At3g0862050.300%Swiss-ProtHigh
Q9ZVI3Arabidopsis thalianasp|Q9ZVI3|QKIL3_ARATH KH domain-containing protein At2g3861050.700%Swiss-ProtHigh
Q0WLR1Arabidopsis thalianasp|Q0WLR1|QKIL1_ARATH KH domain-containing protein At4g2648046.100%Swiss-ProtMedium
Q75GR5Oryza sativa subsp. japonicasp|Q75GR5|SPIN1_ORYSJ KH domain-containing protein SPIN155.800%Swiss-ProtHigh

JBrowse

View in Genome Browser