TkA02G076650 | RubberDandelionOmics

Gene overview

TkA02G076650

Reference: TK1151 Chr: Chr02 Coordinates: 19889761-19894488 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2846 bp · TkA02G076650|TK1151|cDNA

TGTTACTACAAATTTTCGATATAACAAACTCATGGATGAAAAATTCAAAGGTTTTGTAGAAAATCATGTGTAGAAATCAAGCCCATATATAAAATCCCTACTTTTTGGTTTAATTGTGATGATTTATGATCCCTTCAAGAGGGTAAATTTTATTTTTTAATGGTTTTTCTGCTCAATCTTTTGTATTTTTCACACAATTTCACTGTGTGTGTGTGTGTCTGTTCCGTTCTCCAGCTTTTATGGCGTGAGGCCATACAAGT...

CDS

Download CDS FASTA

1803 bp · TkA02G076650|TK1151|CDS

ATGGTCGAGCGAATTGGAATCACTAATGAGAGTATCAAGGATGACGACGAGCTTGAATTGTTGTTGGGTGAGATCCCTCATGCAACATCATCACTTACCCACCATCATCATCACCCATCACATGTCAATGATAATGGTTACGACCCTGTTCTATCTCAGACCATTAATGGAACGATGTATGGTATGTATGATGATGACCCATCATGCAGTTACAAGCAGAATTCATGTATTTTCCCTGCTACCAATGGCTCCTTTTCAAG...

Protein

Download Protein FASTA

600 aa · TkA02G076650|TK1151|PROTEIN

MVERIGITNESIKDDDELELLLGEIPHATSSLTHHHHHPSHVNDNGYDPVLSQTINGTMYGMYDDDPSCSYKQNSCIFPATNGSFSSFFSKDDPTPKPHMMFRTYSSILPYYGKKFDDNLFSESGNQGEDLVRDPNVGTNRINFSKPFSDYAVNQSHSSRFATEFSPFYGFQQIPPHRAENFFPQSHFNRNVLNLRYPVTYPRAIPSLYTAPQNEDSLIIHGETVNHVRNSHKVIGGFRGHIKKCSLHEKRSQIESNHNH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G076650`
TK1151 ID	TkA02G076650
OH-1004 ID	LXL04_017073
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G076650

Location Chr02:19889761-19894488 (-)

Description Similar to APUM7: Putative pumilio homolog 7, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78160`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At1g22240`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At5g56510`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At4g08840`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At1g35730`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017073 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0010608 post-transcriptional regulation of gene expression Biological Process

GO:1902039 negative regulation of seed dormancy process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G22240

ath:AT1G35730

ath:AT1G78160

ath:AT4G08840

ath:AT5G56510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.612

Rank 1 · TkA02G076650 · TK1151

Nucleus0.445

Rank 2 · TkA02G076650 · TK1151

Cell membrane0.092

Rank 3 · TkA02G076650 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA02G076650 · TK1151

Plastid0.030

Rank 5 · TkA02G076650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22493PUF_NOP9282-542 aa

PF00806PUF285-318 aa

PF00806PUF321-355 aa

PF00806PUF362-388 aa

PF00806PUF399-428 aa

PF00806PUF434-466 aa

PF00806PUF472-488 aa

PF00806PUF505-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G076650	`PF22493`	PUF_NOP9	282	542	2.3e-21	77.0
TkA02G076650	`PF00806`	PUF	285	318	4e-63	209.1
TkA02G076650	`PF00806`	PUF	321	355	4e-63	209.1
TkA02G076650	`PF00806`	PUF	362	388	4e-63	209.1
TkA02G076650	`PF00806`	PUF	399	428	4e-63	209.1
TkA02G076650	`PF00806`	PUF	434	466	4e-63	209.1
TkA02G076650	`PF00806`	PUF	472	488	4e-63	209.1
TkA02G076650	`PF00806`	PUF	505	539	4e-63	209.1
TkA02G076650	`PF00806`	PUF	543	576	4e-63	209.1
TkA02G076650	`PF22493`	PUF_NOP9	544	585	2.3e-21	77.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9R6`	Arabidopsis thaliana	sp\|Q9C9R6\|PUM7_ARATH Putative pumilio homolog 7, chloroplastic	45.200%	Swiss-Prot	Medium
`Q9LM20`	Arabidopsis thaliana	sp\|Q9LM20\|PUM8_ARATH Putative pumilio homolog 8, chloroplastic	55.100%	Swiss-Prot	Medium
`Q9LVC3`	Arabidopsis thaliana	sp\|Q9LVC3\|PUM12_ARATH Pumilio homolog 12	47.500%	Swiss-Prot	Medium
`Q9LDW3`	Arabidopsis thaliana	sp\|Q9LDW3\|PUM11_ARATH Pumilio homolog 11	50.200%	Swiss-Prot	Medium
`Q1PFN9`	Arabidopsis thaliana	sp\|Q1PFN9\|PUM9_ARATH Pumilio homolog 9	48.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card