TkA02G047850 | RubberDandelionOmics

Gene overview

TkA02G047850

Reference: TK1151 Chr: Chr02 Coordinates: 12418593-12420595 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

723 bp · TkA02G047850|TK1151|cDNA

ATGCTCCTGCGACCTGACGAAACATTCAACCGGGAGCTCGCCGAGTTTCTTGACCGGAAAGTGGTTGTGAATACGGTTCCGGTGGATGGTGTTTACTCATATGACGTGGTTGACCGTGCTACTAGTCTTCTCAACCAGATTTATAGATGCGCTCCACCGGAAAATGAGTCTACTCGGCAACACGGTGCCGGAATCATAGAGCTGCAGAAACGCCTTAAACAAGAAGATGAAGAAGAAGTTAACGCAAAAGCCAAAACCCG...

CDS

Download CDS FASTA

723 bp · TkA02G047850|TK1151|CDS

ATGCTCCTGCGACCTGACGAAACATTCAACCGGGAGCTCGCCGAGTTTCTTGACCGGAAAGTGGTTGTGAATACGGTTCCGGTGGATGGTGTTTACTCATATGACGTGGTTGACCGTGCTACTAGTCTTCTCAACCAGATTTATAGATGCGCTCCACCGGAAAATGAGTCTACTCGGCAACACGGTGCCGGAATCATAGAGCTGCAGAAACGCCTTAAACAAGAAGATGAAGAAGAAGTTAACGCAAAAGCCAAAACCCG...

Protein

Download Protein FASTA

240 aa · TkA02G047850|TK1151|PROTEIN

MLLRPDETFNRELAEFLDRKVVVNTVPVDGVYSYDVVDRATSLLNQIYRCAPPENESTRQHGAGIIELQKRLKQEDEEEVNAKAKTRRVIARDRLAANEHLMNHYFNDDALDDASSFQFIQQRPDAPGYMGFSMIHKCENVARSEDKKKVARVMYTCIMLHNMILEDEGKAICTHVESENGNPIVPPIQPGSPQVLAIREALRNREIHHNLRNDFAEHFWHVNHIDLNMIPKDDTEGFSD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G047850`
TK1151 ID	TkA02G047850
OH-1004 ID	LXL04_002104
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	47.600
Protein coverage (%)	TK1151 66.667 / OH-1004 44.789 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G047850

Location Chr02:12418593-12420595 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05120`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x
`At5g27320`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x
`At3g63010`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0407500`	Functions as a soluble gibberellin (GA) receptor.	GIBBERELLIN INSENSITIVE DWARF1 encodes a soluble receptor for gibberellin.2005 · DOI: 10.1038/nature04028

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002104 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.748

Rank 1 · TkA02G047850 · TK1151

Cytoplasm0.292

Rank 2 · TkA02G047850 · TK1151

Mitochondrion0.039

Rank 3 · TkA02G047850 · TK1151

Cell membrane0.027

Rank 4 · TkA02G047850 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkA02G047850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06869DUF125863-83 aa

PF04827Plant_tran139-170 aa

PF06869DUF1258188-223 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G047850	`PF06869`	DUF1258	63	83	0.12	12.6
TkA02G047850	`PF04827`	Plant_tran	139	170	1.3e-05	25.7
TkA02G047850	`PF06869`	DUF1258	188	223	0.12	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MAA7`	Arabidopsis thaliana	sp\|Q9MAA7\|GID1A_ARATH Gibberellin receptor GID1A	50.700%	Swiss-Prot	Low
`Q940G6`	Arabidopsis thaliana	sp\|Q940G6\|GID1C_ARATH Gibberellin receptor GID1C	63.500%	Swiss-Prot	Low
`Q9LYC1`	Arabidopsis thaliana	sp\|Q9LYC1\|GID1B_ARATH Gibberellin receptor GID1B	50.000%	Swiss-Prot	Low
`Q6L545`	Oryza sativa subsp. japonica	sp\|Q6L545\|GID1_ORYSJ Gibberellin receptor GID1	40.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card