Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1358 bp · TkA02G045590|TK1151|cDNA
CACTGGTTCTATAATTCTATAAGGCAACGGGAAGAGGGTTTTACAGAGAACCAGGGTTTTCAAACCCTAGAGAGAGAGCGATACAAAAGAGGGAACGAAATGGAAGGAGCTTCATACCAGAGGTTCCCCAAGGTCAAAATCCGTGAACTTAAAGATGACTACGCCAAATTTGAGCTCAGAGAAACCGACGCCAGCATGGCCAATGCACTCCGTCGCGTCATGATAGCCGAGGTTCCGACCATCGCCATCGATCTCGTCGA...
1065 bp · TkA02G045590|TK1151|CDS
CACTGGTTCTATAATTCTATAAGGCAACGGGAAGAGGGTTTTACAGAGAACCAGGGTTTTCAAACCCTAGAGAGAGAGCGATACAAAAGAGGGAACGAAATGGAAGGAGCTTCATACCAGAGGTTCCCCAAGGTCAAAATCCGTGAACTTAAAGATGACTACGCCAAATTTGAGCTCAGAGAAACCGACGCCAGCATGGCCAATGCACTCCGTCGCGTCATGATAGCCGAGGTTCCGACCATCGCCATCGATCTCGTCGA...
Protein
Download Protein FASTA354 aa · TkA02G045590|TK1151|PROTEIN
HWFYNSIRQREEGFTENQGFQTLERERYKRGNEMEGASYQRFPKVKIRELKDDYAKFELRETDASMANALRRVMIAEVPTIAIDLVEIEVNSSVLGDEFIAHRLGLIPLTSERAMSMRFSRDCDACDGDGQCEFCSVEFHLRAKCINDQTLDVTSKDLYSSDHTVVPVDFSDSSSGFENPEDQRGITIVKLRKGQELRLRAIARKGIGKDHAKWSPAATVTFMYEPEIHINEEMMETLSLEEKTSVVESSPTKVFGINPH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G045590 |
|---|---|
| TK1151 ID | TkA02G045590 |
| OH-1004 ID | LXL04_017386 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 90.678 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G045590 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:11743470-11745102 (-) | |||||||||
| Description | Similar to NRPB3: DNA-directed RNA polymerases II, IV and V subunit 3 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006366 transcription by RNA polymerase II Biological Process GO:0006367 transcription initiation at RNA polymerase II promoter Biological Process GO:0006368 transcription elongation by RNA polymerase II Biological Process GO:0010374 stomatal complex development Biological Process GO:0010375 stomatal complex patterning Biological Process GO:0000418 RNA polymerase IV complex Cellular Component GO:0000419 RNA polymerase V complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005665 RNA polymerase II, core complex Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT2G15400 ath:AT2G15430 bta:504452 ddi:DDB_G0292244 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01193RNA_pol_L56-327 aaPF01000RNA_pol_A_bac88-213 aaPF14919MTBP_mid255-330 aaPF01000RNA_pol_A_bac296-335 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G045590 | PF01193 | RNA_pol_L | 56 | 327 | 1.3e-20 | 73.6 |
| TkA02G045590 | PF01000 | RNA_pol_A_bac | 88 | 213 | 4e-21 | 76.2 |
| TkA02G045590 | PF14919 | MTBP_mid | 255 | 330 | 0.036 | 14.1 |
| TkA02G045590 | PF01000 | RNA_pol_A_bac | 296 | 335 | 4e-21 | 76.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.