TkA02G020680 | RubberDandelionOmics

Gene overview

TkA02G020680

Reference: TK1151 Chr: Chr02 Coordinates: 4887573-4888655 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

651 bp · TkA02G020680|TK1151|cDNA

ATGGGCTGCAGACTGCAAGTTCTGAGTAAATGTGAAGATCTCTTAAAAAAACCACTTCACTTTGATGATGGGTTTGCTTTTGATCAAGGAAATGTTGAAAGAAGACAAACATTTCACAATAGGAGTTCCTTCAGCAGTATGATGCACATAAACCTGGAGACACATTTCAAAATATCTCAGAGGACTTCCGAAATGGCTGCTTCTTGTGATGGCACAGTTCACAGATGGAATAGCCGATCAGGAAAGGGCATATCCGTCAT...

CDS

Download CDS FASTA

651 bp · TkA02G020680|TK1151|CDS

ATGGGCTGCAGACTGCAAGTTCTGAGTAAATGTGAAGATCTCTTAAAAAAACCACTTCACTTTGATGATGGGTTTGCTTTTGATCAAGGAAATGTTGAAAGAAGACAAACATTTCACAATAGGAGTTCCTTCAGCAGTATGATGCACATAAACCTGGAGACACATTTCAAAATATCTCAGAGGACTTCCGAAATGGCTGCTTCTTGTGATGGCACAGTTCACAGATGGAATAGCCGATCAGGAAAGGGCATATCCGTCAT...

Protein

Download Protein FASTA

216 aa · TkA02G020680|TK1151|PROTEIN

MGCRLQVLSKCEDLLKKPLHFDDGFAFDQGNVERRQTFHNRSSFSSMMHINLETHFKISQRTSEMAASCDGTVHRWNSRSGKGISVISESSGQYGTSSRNSDQANMLDFCSLRSGFLSNSYDARVYTCTHHLETLNRLLTRTGNGSLRLLDSRSGNLINSWQAHDGYVTKVWFCFQFLSCCFFFMLYIWVFSSVNFNLFTLYTPHGKRFNTPKKCR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G020680`
TK1151 ID	TkA02G020680
OH-1004 ID	LXL04_027999
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 94.737 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G020680

Location Chr02:4887573-4888655 (-)

Description Similar to GFS12: Protein GFS12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18525`	May act predominantly to suppress BCHC1, which itself is a negative factor in protein storage vacuole (PSV) trafficking regulation and plant effector triggered immunity (ETI).	BEACH-domain proteins act together in a cascade to mediate vacuolar protein trafficking and disease resistance in Arabidopsis.2015 · DOI: 10.1016/j.molp.2014.11.015

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027999 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:2000643 positive regulation of early endosome to late endosome transport Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005770 late endosome Cellular Component

GO:0080008 Cul4-RING E3 ubiquitin ligase complex Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G18525

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.511

Rank 1 · TkA02G020680 · TK1151

Cytoplasm0.374

Rank 2 · TkA02G020680 · TK1151

Mitochondrion0.113

Rank 3 · TkA02G020680 · TK1151

Cell membrane0.045

Rank 4 · TkA02G020680 · TK1151

Golgi apparatus0.042

Rank 5 · TkA02G020680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14397ATPgrasp_ST57-120 aa

PF25172Beta-prop_WDR3_2nd59-89 aa

PF25174Beta-prop_THOC364-172 aa

PF25175Beta-prop_WDR565-122 aa

PF25171Beta-prop_WDR36-Utp21_1st67-91 aa

PF12894ANAPC4_WD4068-92 aa

PF25175Beta-prop_WDR5123-189 aa

PF25171Beta-prop_WDR36-Utp21_1st125-169 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G020680	`PF14397`	ATPgrasp_ST	57	120	0.14	12.0
TkA02G020680	`PF25172`	Beta-prop_WDR3_2nd	59	89	0.067	13.1
TkA02G020680	`PF25174`	Beta-prop_THOC3	64	172	0.0057	16.4
TkA02G020680	`PF25175`	Beta-prop_WDR5	65	122	0.016	15.2
TkA02G020680	`PF25171`	Beta-prop_WDR36-Utp21_1st	67	91	0.1	12.7
TkA02G020680	`PF12894`	ANAPC4_WD40	68	92	0.032	15.2
TkA02G020680	`PF25175`	Beta-prop_WDR5	123	189	0.016	15.2
TkA02G020680	`PF25171`	Beta-prop_WDR36-Utp21_1st	125	169	0.1	12.7
TkA02G020680	`PF25172`	Beta-prop_WDR3_2nd	127	172	0.067	13.1
TkA02G020680	`PF12894`	ANAPC4_WD40	137	173	0.032	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JY12`	Arabidopsis thaliana	sp\|F4JY12\|GFS12_ARATH Protein GFS12	39.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card