TkA02G020510 | RubberDandelionOmics

Gene overview

TkA02G020510

Reference: TK1151 Chr: Chr02 Coordinates: 4833638-4834263 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

354 bp · TkA02G020510|TK1151|cDNA

ATGGCGAGACCTCCTTCCAATATGGAATATTTTGGGCTTTCAGTCTTCATTCAAGAAGGAAAATGGTATCGCAATATTGTTCGCAATGCATATTACGTTGCTCCAGAAGTGTTGAAGCGTAAATACGGAAACGAAATAGGTATATGGAGTGTAGGTGTGATGTTATACATCTTACTCAGTGGTGTACCTCCATTTTGGGCTGGAATATTTGACGAGATTCTGAAAAGCGAGATTGATTTCGAAAGCGAACCATGGCCATC...

CDS

Download CDS FASTA

354 bp · TkA02G020510|TK1151|CDS

ATGGCGAGACCTCCTTCCAATATGGAATATTTTGGGCTTTCAGTCTTCATTCAAGAAGGAAAATGGTATCGCAATATTGTTCGCAATGCATATTACGTTGCTCCAGAAGTGTTGAAGCGTAAATACGGAAACGAAATAGGTATATGGAGTGTAGGTGTGATGTTATACATCTTACTCAGTGGTGTACCTCCATTTTGGGCTGGAATATTTGACGAGATTCTGAAAAGCGAGATTGATTTCGAAAGCGAACCATGGCCATC...

Protein

Download Protein FASTA

117 aa · TkA02G020510|TK1151|PROTEIN

MARPPSNMEYFGLSVFIQEGKWYRNIVRNAYYVAPEVLKRKYGNEIGIWSVGVMLYILLSGVPPFWAGIFDEILKSEIDFESEPWPSISTSAKHLVQRMLTLDPKKRITSAQVHGML

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G020510`
TK1151 ID	TkA02G020510
OH-1004 ID	LXL04_017626
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G020510

Location Chr02:4833638-4834263 (-)

Description Similar to CPK19: Calcium-dependent protein kinase 19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04720`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At1g50700`	Ca(2+)-dependent protein kinase.	THI1, a Thiamine Thiazole Synthase, Interacts with Ca2+-Dependent Protein Kinase CPK33 and Modulates the S-Type Anion Channels and Stomatal Closure in Arabidopsis.2016 · DOI: 10.1104/pp.15.01649

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0515100`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017626 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G50700

ath:AT3G20410

dosa:Os07g0515100

osa:4343373

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.587

Rank 1 · TkA02G020510 · TK1151

Nucleus0.517

Rank 2 · TkA02G020510 · TK1151

Mitochondrion0.043

Rank 3 · TkA02G020510 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA02G020510 · TK1151

Cell membrane0.033

Rank 5 · TkA02G020510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase11-113 aa

PF07714PK_Tyr_Ser-Thr11-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G020510	`PF00069`	Pkinase	11	113	3.8e-22	79.7
TkA02G020510	`PF07714`	PK_Tyr_Ser-Thr	11	115	0.0031	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZSA2`	Arabidopsis thaliana	sp\|Q9ZSA2\|CDPKL_ARATH Calcium-dependent protein kinase 21	75.700%	Swiss-Prot	High
`Q9C6P3`	Arabidopsis thaliana	sp\|Q9C6P3\|CDPKX_ARATH Calcium-dependent protein kinase 33	72.900%	Swiss-Prot	High
`P53683`	Oryza sativa subsp. japonica	sp\|P53683\|CDPKJ_ORYSJ Calcium-dependent protein kinase 19	76.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card