TkA02G011540 | RubberDandelionOmics

Gene overview

TkA02G011540

Reference: TK1151 Chr: Chr02 Coordinates: 2544032-2552215 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1535 bp · TkA02G011540|TK1151|cDNA

CTTGGGCCCAGTCGGCCTTATATACAAACAAAGACCGGGCTCCTGGCACACGCGAGGCCCGTCGATTTCCCCCAAATTGTCTTAATAATAACACATCCTTCTCCGGCCACCGCCCACCGGCAACTCTCACACACTCCTAAACCTTACACTGCTTCTTTCTCATTTCCCGACGCCGGACGACAAAGTTTTGCGAAATGATGTTCTCCAGAGGTGCAAAACAGTGTATTGAGATTCTTTGCAGGCGAGTGAGCACTCCTATA...

CDS

Download CDS FASTA

1431 bp · TkA02G011540|TK1151|CDS

ATGAGCTTTAGAGGTGGACGTGACAGACATTGGAAGGACTATCCTTTGAGACCGGAAGAGAAAAGTCACCATGGCCGGAGCACTGCACCTCCTTCAAGACATCTGTGGGTTGGGAATCTATCTCATACCTTAACTGAACGTGCATTGAGCAATCACTTTAGACAATTTGGGGAGCTTGAAAGTGTAGGATTCTCACCTGGTCGTAGCTACGCCTTTGTCAATTTCATTGAAGTCAGTGCGGCTTTTGCAGCAATTGGAGC...

Protein

Download Protein FASTA

476 aa · TkA02G011540|TK1151|PROTEIN

MSFRGGRDRHWKDYPLRPEEKSHHGRSTAPPSRHLWVGNLSHTLTERALSNHFRQFGELESVGFSPGRSYAFVNFIEVSAAFAAIGALQGFILAGNALRIEFTKAFCEMMFSRGAKQCIEILCRRVSTPIHSRYGYSTQTYRENFVSKPNYVINHSTLVRKYSTEVSPSDHMNLIKKLRERTSAPIKEVKAALIDCNWDLEAAQKELRKRGIVLASKKSSRTAAEGLLALAQNDTKAAVIELNCETDFVARNEIFQYLAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G011540`
TK1151 ID	TkA02G011540
OH-1004 ID	LXL04_017682
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 64.076 / OH-1004 96.519 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G011540

Location Chr02:2544032-2552215 (-)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g11120`	Associates with the EF-Tu.GDP complex and induces the exchange of GDP to GTP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0399600`	Associates with the EF-Tu.GDP complex and induces the exchange of GDP to GTP.	No verified direct reference in this release
`UniProt: B8BAI9`	Associates with the EF-Tu.GDP complex and induces the exchange of GDP to GTP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017682 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0070125 mitochondrial translational elongation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003746 translation elongation factor activity Molecular Function

GO:0005085 guanyl-nucleotide exchange factor activity Molecular Function

KEGG gene cross-reference

ath:AT4G11120

dosa:Os08g0399600

rcu:8288301

sly:544215

zma:100194093

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.786

Rank 1 · TkA02G011540 · TK1151

Cytoplasm0.168

Rank 2 · TkA02G011540 · TK1151

Nucleus0.106

Rank 3 · TkA02G011540 · TK1151

Plastid0.074

Rank 4 · TkA02G011540 · TK1151

Peroxisome0.031

Rank 5 · TkA02G011540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_135-99 aa

PF25701RRM_YTH135-87 aa

PF16842RRM_occluded35-100 aa

PF00889EF_TS140-166 aa

PF06972GIP1_N169-205 aa

PF22566UBA_8174-203 aa

PF00889EF_TS245-472 aa

PF06972GIP1_N395-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G011540	`PF00076`	RRM_1	35	99	4.5e-11	43.2
TkA02G011540	`PF25701`	RRM_YTH1	35	87	0.0098	16.4
TkA02G011540	`PF16842`	RRM_occluded	35	100	0.05	14.2
TkA02G011540	`PF00889`	EF_TS	140	166	1.6e-48	165.7
TkA02G011540	`PF06972`	GIP1_N	169	205	0.11	13.5
TkA02G011540	`PF22566`	UBA_8	174	203	0.26	11.9
TkA02G011540	`PF00889`	EF_TS	245	472	1.6e-48	165.7
TkA02G011540	`PF06972`	GIP1_N	395	418	0.11	13.5
TkA02G011540	`PF16842`	RRM_occluded	439	454	0.05	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XF75`	Arabidopsis thaliana	sp\|Q5XF75\|EFTS_ARATH Elongation factor Ts, mitochondrial	64.200%	Swiss-Prot	High
`Q6ZJS7`	Oryza sativa subsp. japonica	sp\|Q6ZJS7\|EFTS_ORYSJ Elongation factor Ts, mitochondrial	64.300%	Swiss-Prot	High
`B8BAI9`	Oryza sativa subsp. indica	sp\|B8BAI9\|EFTS_ORYSI Elongation factor Ts, mitochondrial	63.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card