TkA02G011450 | RubberDandelionOmics

Gene overview

TkA02G011450

Reference: TK1151 Chr: Chr02 Coordinates: 2524143-2527062 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1206 bp · TkA02G011450|TK1151|cDNA

ATGAGGGAAGAAGGAATAAGCTCGTCGGGGGAGACCCATTACTCTTCCGCAATTCGTCTCCCGCCCTCCCACCCCCGCTGCCAGTTATCGTATGTGGAAGTCAATTCTGCTGGGGCTTCATCACCTGCTGTTGCCACTAATGCTGGTAGCACAGATTGGTTGGGGTCCAAAGTAGGTTCCATATCTCGAGTTGGCTCACAGCCCATGTGGATTTCATTAAGTGCAAATTCGGTTCTTGGGTCATCTCAGCCTTCATGTAG...

CDS

Download CDS FASTA

1206 bp · TkA02G011450|TK1151|CDS

ATGAGGGAAGAAGGAATAAGCTCGTCGGGGGAGACCCATTACTCTTCCGCAATTCGTCTCCCGCCCTCCCACCCCCGCTGCCAGTTATCGTATGTGGAAGTCAATTCTGCTGGGGCTTCATCACCTGCTGTTGCCACTAATGCTGGTAGCACAGATTGGTTGGGGTCCAAAGTAGGTTCCATATCTCGAGTTGGCTCACAGCCCATGTGGATTTCATTAAGTGCAAATTCGGTTCTTGGGTCATCTCAGCCTTCATGTAG...

Protein

Download Protein FASTA

401 aa · TkA02G011450|TK1151|PROTEIN

MREEGISSSGETHYSSAIRLPPSHPRCQLSYVEVNSAGASSPAVATNAGSTDWLGSKVGSISRVGSQPMWISLSANSVLGSSQPSCRPWERDSWTPTEGENCYNLGEEFGNQLDEGHKVICPWRGNSCAESLVQFPPTPPSALIGGYKDRCDGLFQFLYLPIVANSTLEQMRVSRGPEMIDFWFSRILSQLASSGVRQILLLVQRTTEKRRYVYIHVEKNGTDTWRVSAASGINGWVADVEEAATTSNIGVDLDLTMGGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G011450`
TK1151 ID	TkA02G011450
OH-1004 ID	LXL04_008772
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	41.300
Protein coverage (%)	TK1151 19.950 / OH-1004 15.619 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G011450`
Location	Chr02:2524143-2527062 (+)
Description	Similar to zc3hc1: NIPA-like protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008772` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016567 protein ubiquitination Biological Process GO:0051301 cell division Biological Process GO:0005634 nucleus Cellular Component GO:0005635 nuclear envelope Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0031965 nuclear membrane Cellular Component GO:0044615 nuclear pore nuclear basket Cellular Component GO:0008270 zinc ion binding Molecular Function GO:0019901 protein kinase binding Molecular Function
KEGG gene cross-reference	hsa:51530 mmu:232679 pon:100174537 xla:399009 xtr:496709 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.672

Rank 1 · TkA02G011450 · TK1151

Cytoplasm0.261

Rank 2 · TkA02G011450 · TK1151

Cell membrane0.101

Rank 3 · TkA02G011450 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA02G011450 · TK1151

Mitochondrion0.041

Rank 5 · TkA02G011450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07967zf-C3HC104-161 aa

PF29884DUF8598172-248 aa

PF15462Barttin282-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G011450	`PF07967`	zf-C3HC	104	161	1.1e-09	39.2
TkA02G011450	`PF29884`	DUF8598	172	248	0.0094	16.6
TkA02G011450	`PF15462`	Barttin	282	379	0.4	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card