TkA01G638430 | RubberDandelionOmics

Gene overview

TkA01G638430

Reference: TK1151 Chr: Chr01 Coordinates: 161573344-161574607 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

354 bp · TkA01G638430|TK1151|cDNA

ATGGGCCCATTTCGCATATTGAGTTTTGACATTGAGTGTGCGGGTCGTAAGGGCCTTTTCCCTGAACCTACACATGATCCTGTTATTCAGATTGCAAATCTGGTGACCCTGCAGGGAGAGGAACAACCGTTTGTGAAAAATGTCATGACCTTAAAATCATGTTCACCAATTGTTGGTGTTGATGTCATGTCATTCGACACAGAGAGAGAAGTTTTACTGGCTTGGAGGGTAATACAATATGGTACAAGGGAAAGTAAAGA...

CDS

Download CDS FASTA

354 bp · TkA01G638430|TK1151|CDS

ATGGGCCCATTTCGCATATTGAGTTTTGACATTGAGTGTGCGGGTCGTAAGGGCCTTTTCCCTGAACCTACACATGATCCTGTTATTCAGATTGCAAATCTGGTGACCCTGCAGGGAGAGGAACAACCGTTTGTGAAAAATGTCATGACCTTAAAATCATGTTCACCAATTGTTGGTGTTGATGTCATGTCATTCGACACAGAGAGAGAAGTTTTACTGGCTTGGAGGGTAATACAATATGGTACAAGGGAAAGTAAAGA...

Protein

Download Protein FASTA

117 aa · TkA01G638430|TK1151|PROTEIN

MGPFRILSFDIECAGRKGLFPEPTHDPVIQIANLVTLQGEEQPFVKNVMTLKSCSPIVGVDVMSFDTEREVLLAWRVIQYGTRESKEVTLEGRVQFDLLQVPVEDGHCAKMGKMMGT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G638430`
TK1151 ID	TkA01G638430
OH-1004 ID	LXL04_000052
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 80.690 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G638430

Location Chr01:161573344-161574607 (-)

Description Similar to POLD1: DNA polymerase delta catalytic subunit

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63960`	This polymerase possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single-stranded DNA in the 3'- to 5'-direction.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0186400`	This polymerase possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single-stranded DNA in the 3'- to 5'-direction.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000052 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006278 RNA-templated DNA biosynthetic process Biological Process

GO:0006287 base-excision repair, gap-filling Biological Process

GO:0006297 nucleotide-excision repair, DNA gap filling Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0043137 DNA replication, removal of RNA primer Biological Process

GO:0045004 DNA replication proofreading Biological Process

GO:1903459 mitotic DNA replication lagging strand elongation Biological Process

GO:1904161 DNA synthesis involved in UV-damage excision repair Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0043625 delta DNA polymerase complex Cellular Component

KEGG gene cross-reference

ath:AT5G63960

dme:Dmel_CG5949

dosa:Os11g0186400

gmx:548092

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.486

Rank 1 · TkA01G638430 · TK1151

Nucleus0.375

Rank 2 · TkA01G638430 · TK1151

Mitochondrion0.135

Rank 3 · TkA01G638430 · TK1151

Extracellular0.086

Rank 4 · TkA01G638430 · TK1151

Cell membrane0.062

Rank 5 · TkA01G638430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03104DNA_pol_B_exo13-75 aa

PF03104DNA_pol_B_exo177-101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G638430	`PF03104`	DNA_pol_B_exo1	3	75	4e-20	73.0
TkA01G638430	`PF03104`	DNA_pol_B_exo1	77	101	4e-20	73.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVN7`	Arabidopsis thaliana	sp\|Q9LVN7\|DPOD1_ARATH DNA polymerase delta catalytic subunit	52.900%	Swiss-Prot	High
`Q9LRE6`	Oryza sativa subsp. japonica	sp\|Q9LRE6\|DPOD1_ORYSJ DNA polymerase delta catalytic subunit	56.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card