TkA01G637910 | RubberDandelionOmics

Gene overview

TkA01G637910

Reference: TK1151 Chr: Chr01 Coordinates: 161401995-161404737 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

777 bp · TkA01G637910|TK1151|cDNA

ATGGGTTCGACTCGATCCGATCATGGCTCCGGGAAAGAGCGATTGAAATGGACTCAAGAACTCCATGATTTGTTCGAAAAGGCAGTTACTCAGCTTGGAGGTCCTGATCGTGCAACACCTAAGGGTATATTAAAGGCCATGGGGATCACAGGGCTTACTATTTACCATGTTAAAAGCCACTTACAGAAATATAGAATGTCGAAATTTGTTCCGGAAACATCGAGAAGAGAAAGGTTTGAAAAAAGAAGCATATCTGAACT...

CDS

Download CDS FASTA

777 bp · TkA01G637910|TK1151|CDS

ATGGGTTCGACTCGATCCGATCATGGCTCCGGGAAAGAGCGATTGAAATGGACTCAAGAACTCCATGATTTGTTCGAAAAGGCAGTTACTCAGCTTGGAGGTCCTGATCGTGCAACACCTAAGGGTATATTAAAGGCCATGGGGATCACAGGGCTTACTATTTACCATGTTAAAAGCCACTTACAGAAATATAGAATGTCGAAATTTGTTCCGGAAACATCGAGAAGAGAAAGGTTTGAAAAAAGAAGCATATCTGAACT...

Protein

Download Protein FASTA

258 aa · TkA01G637910|TK1151|PROTEIN

MGSTRSDHGSGKERLKWTQELHDLFEKAVTQLGGPDRATPKGILKAMGITGLTIYHVKSHLQKYRMSKFVPETSRRERFEKRSISELFPNFSVTSGAQLNEALQMQMEVQRRLSDQLEVQKNLKLKIEAQSKFLEKLSQEHKTSKPNFTKINKVITSPTSLPSLCDVSESIMKDLESDSDDVDANEMQPKQPKRLRVDEDHDLIPSTQRLKPSSTLNTYNIHLPKSGTPFPPQDNNIFPWSSAFCQSPLVPTWFNSFG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G637910`
TK1151 ID	TkA01G637910
OH-1004 ID	LXL04_000063
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G637910

Location Chr01:161401995-161404737 (+)

Description Similar to PHL7: Myb family transcription factor PHL7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g01060`	Myb family transcription factor PHL7.	No verified direct reference in this release
`At5g06800`	Myb family transcription factor PHL5.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XYN9`	Transcription factor binding to specific DNA sequences of target genes promoters, such as the motif R1BS 5'-NAKATNCN-3' and the motif P1BS 5'-GNATATNC-3' to trigger their expression (By similarity).	No verified direct reference in this release
`Os04g0665600`	Transcription factor binding to specific DNA sequences of target genes promoters, such as the motif R1BS 5'-NAKATNCN-3' and the motif P1BS 5'-GNATATNC-3' to trigger their expression.	An SPX-RLI1 Module Regulates Leaf Inclination in Response to Phosphate Availability in Rice.2018 · DOI: 10.1105/tpc.17.00738 Modulation of nitrate-induced phosphate response by the MYB transcription factor RLI1/HINGE1 in the nucleus.2021 · DOI: 10.1016/j.molp.2020.12.005
`UniProt: A2X0Q0`	Transcription factor involved in phosphate starvation signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000063 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010167 response to nitrate Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010966 regulation of phosphate transport Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0034765 regulation of monoatomic ion transmembrane transport Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048768 root hair cell tip growth Biological Process

KEGG gene cross-reference

ath:AT2G01060

ath:AT4G28610

ath:AT5G06800

dosa:Os04g0665600

osa:4337318

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946

Rank 1 · TkA01G637910 · TK1151

Cytoplasm0.177

Rank 2 · TkA01G637910 · TK1151

Mitochondrion0.023

Rank 3 · TkA01G637910 · TK1151

Cell membrane0.015

Rank 4 · TkA01G637910 · TK1151

Endoplasmic reticulum0.007

Rank 5 · TkA01G637910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding14-65 aa

PF14379Myb_CC_LHEQLE98-140 aa

PF05701WEMBL100-142 aa

PF30276Arminin125-151 aa

PF00249Myb_DNA-binding135-153 aa

PF30276Arminin166-196 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G637910	`PF00249`	Myb_DNA-binding	14	65	4.4e-10	40.2
TkA01G637910	`PF14379`	Myb_CC_LHEQLE	98	140	2.5e-18	66.3
TkA01G637910	`PF05701`	WEMBL	100	142	0.059	12.8
TkA01G637910	`PF30276`	Arminin	125	151	0.66	10.7
TkA01G637910	`PF00249`	Myb_DNA-binding	135	153	4.4e-10	40.2
TkA01G637910	`PF30276`	Arminin	166	196	0.66	10.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJW0`	Arabidopsis thaliana	sp\|Q9SJW0\|PHL7_ARATH Myb family transcription factor PHL7	54.100%	Swiss-Prot	Low
`Q0WVU3`	Arabidopsis thaliana	sp\|Q0WVU3\|PHL5_ARATH Myb family transcription factor PHL5	49.100%	Swiss-Prot	Low
`A2XYN9`	Oryza sativa subsp. indica	sp\|A2XYN9\|RLI1_ORYSI Myb family transcription factor RLI1	53.700%	Swiss-Prot	Low
`Q0J995`	Oryza sativa subsp. japonica	sp\|Q0J995\|RLI1_ORYSJ Myb family transcription factor RLI1	53.700%	Swiss-Prot	Low
`A2X0Q0`	Oryza sativa subsp. indica	sp\|A2X0Q0\|PHR3_ORYSI Protein PHOSPHATE STARVATION RESPONSE 3	46.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card