TkA01G636500 | RubberDandelionOmics

Gene overview

TkA01G636500

Reference: TK1151 Chr: Chr01 Coordinates: 161030106-161030972 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

552 bp · TkA01G636500|TK1151|cDNA

ATGAAGGCCTTTGTTGGGGTTGCAGATGATCTTAATGCAATTATTATTGCATGCAGAGGTACCCAAGAAACCAGCGTACAGAATTGGATTGAGGACCTATTCTGGAAACAACTTGATTCTGAATACCCCGGATGCACAGATGGAAAGGTGCATCATGGGTTCTTTAATGCGTACAATAACACAATTGTGAGGTCTGGAATTCTGGATGGTGTTAGTAGAGCTAAAAAAGTTTATGGAGACATCAAGATTATGGTGACAGG...

CDS

Download CDS FASTA

552 bp · TkA01G636500|TK1151|CDS

ATGAAGGCCTTTGTTGGGGTTGCAGATGATCTTAATGCAATTATTATTGCATGCAGAGGTACCCAAGAAACCAGCGTACAGAATTGGATTGAGGACCTATTCTGGAAACAACTTGATTCTGAATACCCCGGATGCACAGATGGAAAGGTGCATCATGGGTTCTTTAATGCGTACAATAACACAATTGTGAGGTCTGGAATTCTGGATGGTGTTAGTAGAGCTAAAAAAGTTTATGGAGACATCAAGATTATGGTGACAGG...

Protein

Download Protein FASTA

183 aa · TkA01G636500|TK1151|PROTEIN

MKAFVGVADDLNAIIIACRGTQETSVQNWIEDLFWKQLDSEYPGCTDGKVHHGFFNAYNNTIVRSGILDGVSRAKKVYGDIKIMVTGHSMGGAIAAFCGLDLSLIYGKENVSVMTFGQPRIGNAAFASYYSEIVPNTFRITHEHDLVPHLPPYYQHLPHKTYHHFLREVIDRPSVTPQIFWHF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G636500`
TK1151 ID	TkA01G636500
OH-1004 ID	LXL04_025918
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.400
Protein coverage (%)	TK1151 92.350 / OH-1004 48.148 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G636500`
Location	Chr01:161030106-161030972 (+)
Description	Similar to Lipase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025918` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000272 polysaccharide catabolic process Biological Process GO:0006629 lipid metabolic process Biological Process GO:0016042 lipid catabolic process Biological Process GO:0044347 cell wall polysaccharide catabolic process Biological Process GO:0045493 xylan catabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0004806 triacylglycerol lipase activity Molecular Function GO:0016787 hydrolase activity Molecular Function GO:0016788 hydrolase activity, acting on ester bonds Molecular Function GO:0030600 feruloyl esterase activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	ang:An09g00120 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.345

Rank 1 · TkA01G636500 · TK1151

Extracellular0.223

Rank 2 · TkA01G636500 · TK1151

Cytoplasm0.208

Rank 3 · TkA01G636500 · TK1151

Endoplasmic reticulum0.098

Rank 4 · TkA01G636500 · TK1151

Plastid0.049

Rank 5 · TkA01G636500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26363Phospholipase-like14-33 aa

PF01764Lipase_316-153 aa

PF01083Cutinase16-147 aa

PF11187Mbeg1-like60-98 aa

PF12146Hydrolase_473-97 aa

PF26363Phospholipase-like79-96 aa

PF07819PGAP181-96 aa

PF12697Abhydrolase_682-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G636500	`PF26363`	Phospholipase-like	14	33	0.36	10.8
TkA01G636500	`PF01764`	Lipase_3	16	153	1.5e-35	122.9
TkA01G636500	`PF01083`	Cutinase	16	147	0.24	12.1
TkA01G636500	`PF11187`	Mbeg1-like	60	98	0.018	15.1
TkA01G636500	`PF12146`	Hydrolase_4	73	97	0.022	14.8
TkA01G636500	`PF26363`	Phospholipase-like	79	96	0.36	10.8
TkA01G636500	`PF07819`	PGAP1	81	96	0.092	13.2
TkA01G636500	`PF12697`	Abhydrolase_6	82	159	0.14	13.5
TkA01G636500	`PF11187`	Mbeg1-like	95	135	0.018	15.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card