TkA01G632490 | RubberDandelionOmics

Gene overview

TkA01G632490

Reference: TK1151 Chr: Chr01 Coordinates: 160006113-160007364 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1093 bp · TkA01G632490|TK1151|cDNA

GGGGCGGGACAAGACGACGTCGTATTCATTCATCTCCCTCCAATATCCATTCCCCAAAAATCCTGAATGCTATCCCTTCCCCTGTCCTCGCCGAATCCTCGCTCTTACCTTCCAAACCCCTTCTCTCTATCAACCAACAACCCCCGTCTTCATGTATTTACCAACGACCGATTTGCCGGCGGTGGAATTAAGTCTCCGGAGGAACCGATTGGTACTCCGGCGGGTCTCCATCGCGAGTTAATGCCAAAGCACGTTGCAGT...

CDS

Download CDS FASTA

873 bp · TkA01G632490|TK1151|CDS

ATGCTATCCCTTCCCCTGTCCTCGCCGAATCCTCGCTCTTACCTTCCAAACCCCTTCTCTCTATCAACCAACAACCCCCGTCTTCATGTATTTACCAACGACCGATTTGCCGGCGGTGGAATTAAGTCTCCGGAGGAACCGATTGGTACTCCGGCGGGTCTCCATCGCGAGTTAATGCCAAAGCACGTTGCAGTCATCATGGACGGAAACAGGAGATGGGCTCGGTCTCGAGGATTGATGCCTCAGGCGGGTTACTTGGC...

Protein

Download Protein FASTA

290 aa · TkA01G632490|TK1151|PROTEIN

MLSLPLSSPNPRSYLPNPFSLSTNNPRLHVFTNDRFAGGGIKSPEEPIGTPAGLHRELMPKHVAVIMDGNRRWARSRGLMPQAGYLAGAGALKVVVDLCRNWGIHVLTVFAFSSDNWLRPRVEVDFLMGLLESTLKDEVASMSREEIRLSVIGDVSKLPKSLRNFITHCENTTKDNSGLNLVIAINYSGKYDIVQACQSIAQKVKDGVVEPEEINEFMIDDELGGMNLMRFPDPDLLIRTSGEVRVSNFFLWQLAYTELY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G632490`
TK1151 ID	TkA01G632490
OH-1004 ID	LXL04_000125
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 86.207 / OH-1004 47.438 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G632490

Location Chr01:160006113-160007364 (-)

Description Similar to At5g58770: Dehydrodolichyl diphosphate synthase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58770`	Catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier-lipid required for the biosynthesis of several classes of glycoprotein.	No verified direct reference in this release
`At5g58780`	Catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier-lipid required for the biosynthesis of several classes of glycoprotein.	No verified direct reference in this release
`At5g58784`	Catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier-lipid required for the biosynthesis of several classes of glycoprotein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000125 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009668 plastid membrane organization Biological Process

GO:0016094 polyprenol biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004659 prenyltransferase activity Molecular Function

GO:0045547 ditrans,polycis-polyprenyl diphosphate synthase [(2E,6E)-farnesyl diphosphate specific] activity Molecular Function

GO:0120531 prenyl diphosphate synthase activity Molecular Function

KEGG gene cross-reference

ath:AT5G58770

sly:101244138

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.956

Rank 1 · TkA01G632490 · TK1151

Mitochondrion0.069

Rank 2 · TkA01G632490 · TK1151

Cytoplasm0.032

Rank 3 · TkA01G632490 · TK1151

Nucleus0.026

Rank 4 · TkA01G632490 · TK1151

Peroxisome0.021

Rank 5 · TkA01G632490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01255Prenyltransf66-289 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G632490	`PF01255`	Prenyltransf	66	289	1.7e-77	260.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56Y11`	Arabidopsis thaliana	sp\|Q56Y11\|DDPS2_ARATH Dehydrodolichyl diphosphate synthase 2	59.800%	Swiss-Prot	High
`Q8RX73`	Arabidopsis thaliana	sp\|Q8RX73\|DDPS3_ARATH Dehydrodolichyl diphosphate synthase 3	51.300%	Swiss-Prot	High
`Q570Q8`	Arabidopsis thaliana	sp\|Q570Q8\|DDPS5_ARATH Dehydrodolichyl diphosphate synthase 5	54.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card