Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1599 bp · TkA01G628440|TK1151|cDNA
GGTCCACAGTCCACACGTCTTCGCAATCGGCGGTCGTTGGGTTGTGATAGTAGCTTCGAGAACCATCTTCGAAATATAAACGCCTACTATAAGTCATTGATCGGTAGATTACTTCTTTTCGTACCCCGAATTGTAGCTGAAGTAGCAATACAAACTGAACAGAGTTTATTATTAGGGTTTGCGTTTTTCTGATTTTCTCGATAGAAGATTATGGCGAAAGAGGGACCTAGTTGGGACGGGTTGCTCAAGTGGAGTATTGC...
1077 bp · TkA01G628440|TK1151|CDS
ATGGCGAAAGAGGGACCTAGTTGGGACGGGTTGCTCAAGTGGAGTATTGCTCATTCCGATGGCACTGGAACTACTAGAAAATTAAGTGAGGATGATCGGAAATGGTTCATGGAAGCTATGCAAGCTCAAACCATAGATGTGGTTAAACGAATGAAAGAAATAACTCTTGTGATGAAAACTCCCGATAATATCCTGGAGGAACAAGGCGTAACTGCAACAGATCTTGAAGATATGTTGGATGAACTTCAAGAGCATGTCGA...
Protein
Download Protein FASTA358 aa · TkA01G628440|TK1151|PROTEIN
MAKEGPSWDGLLKWSIAHSDGTGTTRKLSEDDRKWFMEAMQAQTIDVVKRMKEITLVMKTPDNILEEQGVTATDLEDMLDELQEHVESIDMANGGLTPLLNYLKNSHANIRAKAAEVVSTIVQNNPKSQQLVMEANGMEPLLTNFTSDDDVTVRTKALGAISSLIRHNKPGIQAFRLSNGYSALKDALSSDNVRFQRKALNLIQYLLQENPSDCNVVTELGFPRIMRHLAGSEDPEVREGALSGLHELSKVEIRETEDEK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G628440 |
|---|---|
| TK1151 ID | TkA01G628440 |
| OH-1004 ID | LXL04_000190 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 94.800 |
| Protein coverage (%) | TK1151 96.089 / OH-1004 95.355Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G628440 |
|---|---|
| Location | Chr01:158908608-158910900 (-) |
| Description | Similar to FES1: Hsp70 nucleotide exchange factor FES1 (Ustilago maydis (strain 521 / FGSC 9021) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006417 regulation of translation Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0071629 cytoplasm protein quality control by the ubiquitin-proteasome system Biological Process GO:0005615 extracellular space Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005829 cytosol Cellular Component GO:0000774 adenyl-nucleotide exchange factor activity Molecular Function GO:0031625 ubiquitin protein ligase binding Molecular Function GO:0140313 molecular sequestering activity Molecular Function |
| KEGG gene cross-reference | afm:AFUA_6G04750 ani:ANIA_06543 mmu:66245 pno:SNOG_01140 uma:UMAG_11735 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03224V-ATPase_H_N8-196 aaPF08609Fes19-93 aaPF11698V-ATPase_H_C37-124 aaPF23195UBQLN141-70 aaPF04558tRNA_synt_1c_R147-135 aaPF20926Htt_N-HEAT_148-125 aaPF14726RTTN_N63-87 aaPF11864DUF338467-161 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G628440 | PF03224 | V-ATPase_H_N | 8 | 196 | 0.019 | 15.2 |
| TkA01G628440 | PF08609 | Fes1 | 9 | 93 | 2.3e-12 | 48.5 |
| TkA01G628440 | PF11698 | V-ATPase_H_C | 37 | 124 | 1.1e-08 | 35.9 |
| TkA01G628440 | PF23195 | UBQLN1 | 41 | 70 | 1.5 | 9.4 |
| TkA01G628440 | PF04558 | tRNA_synt_1c_R1 | 47 | 135 | 0.18 | 12.5 |
| TkA01G628440 | PF20926 | Htt_N-HEAT_1 | 48 | 125 | 0.0066 | 17.5 |
| TkA01G628440 | PF14726 | RTTN_N | 63 | 87 | 0.15 | 13.6 |
| TkA01G628440 | PF11864 | DUF3384 | 67 | 161 | 0.21 | 11.1 |
| TkA01G628440 | PF16782 | SIL1 | 71 | 211 | 1.3e-05 | 25.4 |
| TkA01G628440 | PF23271 | HEAT_GCN1 | 71 | 167 | 4.5e-05 | 24.3 |
| TkA01G628440 | PF22928 | INTS1_R4 | 72 | 134 | 4.2e-05 | 24.1 |
| TkA01G628440 | PF11864 | DUF3384 | 73 | 210 | 0.21 | 11.1 |
| TkA01G628440 | PF21047 | HEAT_Maestro | 77 | 170 | 9e-06 | 26.4 |
| TkA01G628440 | PF01417 | ENTH | 77 | 122 | 0.01 | 16.6 |
| TkA01G628440 | PF24714 | TOR1L1_N | 88 | 199 | 0.0027 | 17.8 |
| TkA01G628440 | PF01602 | Adaptin_N | 89 | 132 | 3.1e-06 | 26.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.