RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G618360
Reference: TK1151 Chr: Chr01 Coordinates: 156026884-156028801 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1146 bp · TkA01G618360|TK1151|cDNA

ATGTCTGGATACCCACATAACACATCGGGATACGGTGCTCCACCACCGTCGTCACAACCACACTCCTCCGCCCCTTACGGCGCCCCAGCACAACCTTACGGTGCCCCAGCACAACCCTACGGCGCCCCAGCACAATCCTACGGTGGTGCTCCTGCACAACCTATGGCGCCCCTGCACAACCCTATGGCGCATCAGCCAGTCCATACGGTGCACCACCGGCTTCAGCCCCTTACGGTGCACATCCAGAAACTAAACCCCCA...

CDS

Download CDS FASTA

624 bp · TkA01G618360|TK1151|CDS

ATGTCTGGATACCCACATAACACATCGGGATACGGTGCTCCACCACCGTCGTCACAACCACACTCCTCCGCCCCTTACGGCGCCCCAGCACAACCTTACGGTGCCCCAGCACAACCCTACGGCGCCCCAGCACAATCCTACGGTGGTGCTCCTGCACAACCTATGGCGCCCCTGCACAACCCTATGGCGCATCAGCCAGTCCATACGGTGCACCACCGGCTTCAGCCCCTTACGGTGCACATCCAGAAACTAAACCCCCA...

Protein

Download Protein FASTA

207 aa · TkA01G618360|TK1151|PROTEIN

MSGYPHNTSGYGAPPPSSQPHSSAPYGAPAQPYGAPAQPYGAPAQSYGGAPAQPMAPLHNPMAHQPVHTVHHRLQPLTVHIQKLNPQKRTNPHPPHTDRHQGDTAAARLRHFCRRRFLQEQIRTSWRASRSPIRTEVESSMIKNCRGHCLRTIKASVFVPFIFLCIPSPTPTLERSGRRNSLKCSTVYRIGGQILRNLIEIVVGRLI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G618360
TK1151 IDTkA01G618360
OH-1004 IDLXL04_000342
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 14.976 / OH-1004 9.936
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G618360
LocationChr01:156026884-156028801 (-)
DescriptionSimilar to CBP: Calcium-binding protein CBP
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000342 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process
GO:0009610 response to symbiotic fungus Biological Process
GO:0048208 COPII vesicle coating Biological Process
GO:1902527 positive regulation of protein monoubiquitination Biological Process
GO:0005634 nucleus Cellular Component
GO:0005783 endoplasmic reticulum Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0030127 COPII vesicle coat Cellular Component
GO:0031463 Cul3-RING ubiquitin ligase complex Cellular Component
GO:0005509 calcium ion binding Molecular Function
GO:0048306 calcium-dependent protein binding Molecular Function
GO:1990756 ubiquitin-like ligase-substrate adaptor activity Molecular Function
KEGG gene cross-reference
ath:AT2G27480
ath:AT3G10300
ath:AT5G04170
dosa:Os12g0137100
osa:4351450
xla:495978
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.529
Rank 1 · TkA01G618360 · TK1151
Cytoplasm0.398
Rank 2 · TkA01G618360 · TK1151
Mitochondrion0.088
Rank 3 · TkA01G618360 · TK1151
Cell membrane0.080
Rank 4 · TkA01G618360 · TK1151
Endoplasmic reticulum0.069
Rank 5 · TkA01G618360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser