TkA01G612740 | RubberDandelionOmics

Gene overview

TkA01G612740

Reference: TK1151 Chr: Chr01 Coordinates: 154454045-154456145 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1330 bp · TkA01G612740|TK1151|cDNA

TTTGTTGTTCGCTCTATGAAATGCGAACATTTTGGACGGAAATGGGATTTAACTGGATTTGGGGGAAATCACCCAACAAAAGGATAAACAAAATCCATTCAGGGGATTCAGGGCTTGCTTAAAATCCGATTACAACGATCACTTCTTTAAATTCTCCTTCCATTTTCCCAAAGATTTTTTTAAATTGCATGCGAACAGCTTGCATCCAATTGAATAATGCTCAGGAGCATACAATTTCTTGGTTCCTCTTCGGGGTTCCT...

CDS

Download CDS FASTA

855 bp · TkA01G612740|TK1151|CDS

ATGCTCAGGAGCATACAATTTCTTGGTTCCTCTTCGGGGTTCCTTTTTCATAGATTAAAACTTCATGGAAATCATTCTGGGCTCTCGTTCATTTCCATTTCTGCGAAACCATCTTCAAGAAGACCTTTATTAACAACCTCAAGAACGCCTCGCTGTATTCGACAATTTCGGGCATCCCCAATTCGTTCCCAGTCAAACCCAGATGTTACCTCACCTTCATCTTCTTCATCACCCACTTTTCGAACAACTGGCAGTCCCAG...

Protein

Download Protein FASTA

284 aa · TkA01G612740|TK1151|PROTEIN

MLRSIQFLGSSSGFLFHRLKLHGNHSGLSFISISAKPSSRRPLLTTSRTPRCIRQFRASPIRSQSNPDVTSPSSSSSPTFRTTGSPSKINFCQLCGGPTKHEIPDGEEKERAICTLCGRISYENPKMVVGCLIEHDNKILLCKRNIEPSFGLWTLPAGYMEIGESATEGAVRETWEEARAKVEVLSPFAQLDIPLIGQTYIIYLAKLLTPHFSPGPESSECRLFALDDIPYESLSFSSMLVTLNLYIEDIKVGKPKFHYG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G612740`
TK1151 ID	TkA01G612740
OH-1004 ID	LXL04_000425
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G612740

Location Chr01:154454045-154456145 (-)

Description Similar to NUDT23: Nudix hydrolase 23, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g42070`	Mediates the hydrolysis of some nucleoside diphosphate derivatives.	Molecular characterization of organelle-type Nudix hydrolases in Arabidopsis.2008 · DOI: 10.1104/pp.108.128413

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000425 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006742 NADP+ catabolic process Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0019677 NAD+ catabolic process Biological Process

GO:0042726 flavin-containing compound metabolic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000210 NAD+ diphosphatase activity Molecular Function

GO:0000287 magnesium ion binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0030145 manganese ion binding Molecular Function

GO:0035529 NADH pyrophosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G42070

eic:NT01EI_0179

mja:MJ_1149

psa:PST_2247

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.697

Rank 1 · TkA01G612740 · TK1151

Plastid0.333

Rank 2 · TkA01G612740 · TK1151

Cytoplasm0.037

Rank 3 · TkA01G612740 · TK1151

Nucleus0.031

Rank 4 · TkA01G612740 · TK1151

Cell membrane0.010

Rank 5 · TkA01G612740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14803Zn_ribbon_Nudix90-123 aa

PF29314zf_C2H2_LIN26-LIR391-100 aa

PF29314zf_C2H2_LIN26-LIR3114-119 aa

PF00293NUDIX127-229 aa

PF14815NUDIX_4129-187 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G612740	`PF14803`	Zn_ribbon_Nudix	90	123	1.2e-13	51.4
TkA01G612740	`PF29314`	zf_C2H2_LIN26-LIR3	91	100	0.37	11.3
TkA01G612740	`PF29314`	zf_C2H2_LIN26-LIR3	114	119	0.37	11.3
TkA01G612740	`PF00293`	NUDIX	127	229	1.1e-13	52.0
TkA01G612740	`PF14815`	NUDIX_4	129	187	0.07	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93740`	Arabidopsis thaliana	sp\|P93740\|NUD23_ARATH Nudix hydrolase 23, chloroplastic	64.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card