TkA01G606550 | RubberDandelionOmics

Gene overview

TkA01G606550

Reference: TK1151 Chr: Chr01 Coordinates: 152834274-152834976 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

608 bp · TkA01G606550|TK1151|cDNA

CCCTCTCCCTTCCAAAATCCATCTCCATGCTTCCATCTCCAACGCCACTCCACACCACCAACATCAAGACAAACCAACCCCCAATCTCCCCCAAACTAAAATCTCCACGGCAGCCGGCCGTCAAACGAGGAGGAAACAGCCACAGCAACGATATGACTTCCAGTTCTGACAAGCTTCTACTGCCCTTACCCACCAAATCTACAACCCCCAAATCCATGATTCCGATAAAAAAATCAAAGAAATGCACTACCACCGGTGAC...

CDS

Download CDS FASTA

582 bp · TkA01G606550|TK1151|CDS

ATGCTTCCATCTCCAACGCCACTCCACACCACCAACATCAAGACAAACCAACCCCCAATCTCCCCCAAACTAAAATCTCCACGGCAGCCGGCCGTCAAACGAGGAGGAAACAGCCACAGCAACGATATGACTTCCAGTTCTGACAAGCTTCTACTGCCCTTACCCACCAAATCTACAACCCCCAAATCCATGATTCCGATAAAAAAATCAAAGAAATGCACTACCACCGGTGACCATCCAGGTAACTTCTACTTGATTCA...

Protein

Download Protein FASTA

193 aa · TkA01G606550|TK1151|PROTEIN

MLPSPTPLHTTNIKTNQPPISPKLKSPRQPAVKRGGNSHSNDMTSSSDKLLLPLPTKSTTPKSMIPIKKSKKCTTTGDHPGNFYLIHLEREATEDEHREIARFVTDNQVFQLVENVMIVGKPNRATYRGPTMLATTLHAMAILLRIDSKWDWFINLSASDYPLVTQDKLISAFSVLPRHLNFIQHSSRLGWKL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G606550`
TK1151 ID	TkA01G606550
OH-1004 ID	LXL04_015889
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 31.485 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G606550

Location Chr01:152834274-152834976 (+)

Description Similar to CALS9: Callose synthase 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g15050`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891
`At5g39990`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	A β-glucuronosyltransferase from Arabidopsis thaliana involved in biosynthesis of type II arabinogalactan has a role in cell elongation during seedling growth.2013 · DOI: 10.1111/tpj.12353
`At2g37585`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015889 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006075 (1->3)-beta-D-glucan biosynthetic process Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0009555 pollen development Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009846 pollen germination Biological Process

GO:0048589 developmental growth Biological Process

GO:0051592 response to calcium ion Biological Process

GO:0052543 callose deposition in cell wall Biological Process

GO:0055047 generative cell mitosis Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0000139 Golgi membrane Cellular Component

KEGG gene cross-reference

ath:AT2G36850

ath:AT2G37585

ath:AT3G07160

ath:AT5G15050

ath:AT5G39990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.222

Rank 1 · TkA01G606550 · TK1151

Extracellular0.214

Rank 2 · TkA01G606550 · TK1151

Cell membrane0.150

Rank 3 · TkA01G606550 · TK1151

Golgi apparatus0.140

Rank 4 · TkA01G606550 · TK1151

Cytoplasm0.097

Rank 5 · TkA01G606550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02485Branch77-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G606550	`PF02485`	Branch	77	192	5.7e-30	105.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFQ0`	Arabidopsis thaliana	sp\|Q9LFQ0\|GT14B_ARATH Beta-glucuronosyltransferase GlcAT14B	58.800%	Swiss-Prot	Medium
`Q9FLD7`	Arabidopsis thaliana	sp\|Q9FLD7\|GT14A_ARATH Beta-glucuronosyltransferase GlcAT14A	56.100%	Swiss-Prot	Medium
`Q8S8P3`	Arabidopsis thaliana	sp\|Q8S8P3\|GT14C_ARATH Beta-glucuronosyltransferase GlcAT14C	51.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card