Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1633 bp · TkA01G604230|TK1151|cDNA
CAAATTACTTTTTTTTATTGTTTTTCATCAACACAAATAACGGATAACGCACACGCGCTCTCTCCTTCTCCCCTCTCATCCGCACACACAAATGAGAAGGTGAGTGAATTGCAGAGAGAGAGAGAGAGAGAGAGCTTCCGGCAATCCATCCATCCATCCATGGCCAAATCTCTTATTTCATCGCCTTCATCCTTCGTCGGAACACCTTTCCCCTCGCTCTATCGCCATGGACGCCTTTCTCCCAGGACTAAGCTTATATC...
1509 bp · TkA01G604230|TK1151|CDS
CAAATTACTTTTTTTTATTGTTTTTCATCAACACAAATAACGGATAACGCACACGCGCTCTCTCCTTCTCCCCTCTCATCCGCACACACAAATGAGAAGGTGAGTGAATTGCAGAGAGAGAGAGAGAGAGAGAGCTTCCGGCAATCCATCCATCCATCCATGGCCAAATCTCTTATTTCATCGCCTTCATCCTTCGTCGGAACACCTTTCCCCTCGCTCTATCGCCATGGACGCCTTTCTCCCAGGACTAAGCTTATATC...
Protein
Download Protein FASTA502 aa · TkA01G604230|TK1151|PROTEIN
QITFFYCFSSTQITDNAHALSPSPLSSAHTNEKVSELQRERERESFRQSIHPSMAKSLISSPSSFVGTPFPSLYRHGRLSPRTKLISTRVKFSFNGLPPISSLDGVSIDLSAIASRAESLMYTLADAAVAVDSAASVSGDSATTTVQKSGGWFGFISDAMEVVLKVLKDGLSAVHIPYSYGFAIILLTVLVKVATLPLTKQQVESTLAMQNLQPKLKAIQQRYAGNQERIQLETSRLYKQAGVNPLAGCLPTLATIPVWI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G604230 |
|---|---|
| TK1151 ID | TkA01G604230 |
| OH-1004 ID | LXL04_000537 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 98.900 |
| Protein coverage (%) | TK1151 89.442 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G604230 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:152268524-152271540 (+) | |||||||||
| Description | Similar to PPF-1: Inner membrane protein PPF-1, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009658 chloroplast organization Biological Process GO:0010027 thylakoid membrane organization Biological Process GO:0045038 protein import into chloroplast thylakoid membrane Biological Process GO:0051205 protein insertion into membrane Biological Process GO:0070208 protein heterotrimerization Biological Process GO:0072598 protein localization to chloroplast Biological Process GO:0005777 peroxisome Cellular Component GO:0009507 chloroplast Cellular Component GO:0009534 chloroplast thylakoid Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0009579 thylakoid Cellular Component GO:0032991 protein-containing complex Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G24490 ath:AT2G28800 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF31132Hel_4HB_N102-138 aaPF0209660KD_IMP179-394 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G604230 | PF31132 | Hel_4HB_N | 102 | 138 | 0.16 | 13.0 |
| TkA01G604230 | PF02096 | 60KD_IMP | 179 | 394 | 3.1e-58 | 197.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.