TkA01G603010 | RubberDandelionOmics

Gene overview

TkA01G603010

Reference: TK1151 Chr: Chr01 Coordinates: 151966199-151972834 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

891 bp · TkA01G603010|TK1151|cDNA

CAGAAAGTTCCCGATCATGTCCTAATCATGTGTATAACAGTATAAATACCAAACCCATTAACAAGTGAAAAGCAAAATCAGCGGATAACAGAATCAGCAAAACCAATCAAGCTAAGCGAATTCTTGTTAAAGACGGTAGAAGAGATGTCGATCATTCCAAGTTTATTTGGTGGCCGACGCAGCAGCGTCTTCGATCCATTCTCACTCGACATTTGGGACCCTTTCAAAGATTTCACCATTTCATCTCCCTCTGATGTCTC...

CDS

Download CDS FASTA

468 bp · TkA01G603010|TK1151|CDS

ATGTCGATCATTCCAAGTTTATTTGGTGGCCGACGCAGCAGCGTCTTCGATCCATTCTCACTCGACATTTGGGACCCTTTCAAAGATTTCACCATTTCATCTCCCTCTGATGTCTCAAGAGAAACCTCCGCATTGGTAAACACCCGTGTGGATTGGAAGGAAACCCCAGAAGCCCATGTGTTCAAGGCGGATCTTCCGGGGATCAAGAAAGAAGAAGTCAAGGTGGAGGTAGAAGACGACAGAATCCTACAAATCAGTGG...

Protein

Download Protein FASTA

155 aa · TkA01G603010|TK1151|PROTEIN

MSIIPSLFGGRRSSVFDPFSLDIWDPFKDFTISSPSDVSRETSALVNTRVDWKETPEAHVFKADLPGIKKEEVKVEVEDDRILQISGERNVEKEDKNDTWHRVERSSGKFTRRFRLPENAKMDQVKAAMENGVLTITVPKEEVKKPDVKHIQISG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G603010`
TK1151 ID	TkA01G603010
OH-1004 ID	LXL04_000551
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 95.679 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G603010`
Location	Chr01:151966199-151972834 (-)
Description	Similar to HSP17.3-B: 17.3 kDa class I heat shock protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000551` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0009408 response to heat Biological Process GO:0009651 response to salt stress Biological Process GO:0042542 response to hydrogen peroxide Biological Process GO:0051259 protein complex oligomerization Biological Process GO:0005737 cytoplasm Cellular Component GO:0051082 unfolded protein binding Molecular Function
KEGG gene cross-reference	gmx:100305750 gmx:100499727 gmx:100526870 gmx:100791172 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.718

Rank 1 · TkA01G603010 · TK1151

Nucleus0.374

Rank 2 · TkA01G603010 · TK1151

Mitochondrion0.102

Rank 3 · TkA01G603010 · TK1151

Cell membrane0.085

Rank 4 · TkA01G603010 · TK1151

Endoplasmic reticulum0.063

Rank 5 · TkA01G603010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF31004IDM_C49-133 aa

PF04969CS49-140 aa

PF00011HSP2051-154 aa

PF23444DUF712754-92 aa

PF27746Small_heat_shock_put60-139 aa

PF18046FKBP26_C60-82 aa

PF17886ArsA_HSP2061-137 aa

PF18046FKBP26_C115-141 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G603010	`PF31004`	IDM_C	49	133	3.1e-05	24.3
TkA01G603010	`PF04969`	CS	49	140	0.13	14.0
TkA01G603010	`PF00011`	HSP20	51	154	2.4e-33	115.0
TkA01G603010	`PF23444`	DUF7127	54	92	0.0024	19.0
TkA01G603010	`PF27746`	Small_heat_shock_put	60	139	0.00019	21.5
TkA01G603010	`PF18046`	FKBP26_C	60	82	0.00084	20.2
TkA01G603010	`PF17886`	ArsA_HSP20	61	137	5e-05	23.5
TkA01G603010	`PF18046`	FKBP26_C	115	141	0.00084	20.2
TkA01G603010	`PF23444`	DUF7127	124	138	0.0024	19.0
TkA01G603010	`PF04969`	CS	134	149	0.13	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card