TkA01G602990 | RubberDandelionOmics

Gene overview

TkA01G602990

Reference: TK1151 Chr: Chr01 Coordinates: 151959168-151959626 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

459 bp · TkA01G602990|TK1151|cDNA

ATGCCAAGTTTCTTTGGTGGCCGACGCAGCAGCGTCTTCGATCCATTCTCACTCGACGTCTGGGACCCTTTCAATAATTTCCCCATTTCATCTCCATCTGATGTCTCCAGAGAAACCTCGGCGTTGGTAAACACCCGTGTGGATTGGAAGGAAACCCCAGAAGCCCATGTGTTCAAGGCCGATCTTCCTGGAATCAAGAAAGAAGAAGTCAAGGTGGAGGTTAAAGACGACCGGATCCTACGAATCAGTGGCGAAAGAAA...

CDS

Download CDS FASTA

459 bp · TkA01G602990|TK1151|CDS

ATGCCAAGTTTCTTTGGTGGCCGACGCAGCAGCGTCTTCGATCCATTCTCACTCGACGTCTGGGACCCTTTCAATAATTTCCCCATTTCATCTCCATCTGATGTCTCCAGAGAAACCTCGGCGTTGGTAAACACCCGTGTGGATTGGAAGGAAACCCCAGAAGCCCATGTGTTCAAGGCCGATCTTCCTGGAATCAAGAAAGAAGAAGTCAAGGTGGAGGTTAAAGACGACCGGATCCTACGAATCAGTGGCGAAAGAAA...

Protein

Download Protein FASTA

152 aa · TkA01G602990|TK1151|PROTEIN

MPSFFGGRRSSVFDPFSLDVWDPFNNFPISSPSDVSRETSALVNTRVDWKETPEAHVFKADLPGIKKEEVKVEVKDDRILRISGERNVEKEYKNDTWHRVERSSGKFNRRFRLPENAKLDQVKAAMENGVLTITVPKEEVKKPDVKSIEISG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G602990`
TK1151 ID	TkA01G602990
OH-1004 ID	LXL04_000551
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 93.827 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G602990`
Location	Chr01:151959168-151959626 (-)
Description	Similar to HSP17.3-B: 17.3 kDa class I heat shock protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000551` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0009408 response to heat Biological Process GO:0009651 response to salt stress Biological Process GO:0042542 response to hydrogen peroxide Biological Process GO:0051259 protein complex oligomerization Biological Process GO:0005737 cytoplasm Cellular Component GO:0051082 unfolded protein binding Molecular Function
KEGG gene cross-reference	gmx:100305750 gmx:100499727 gmx:100526870 gmx:100791172 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.714

Rank 1 · TkA01G602990 · TK1151

Nucleus0.401

Rank 2 · TkA01G602990 · TK1151

Mitochondrion0.092

Rank 3 · TkA01G602990 · TK1151

Cell membrane0.076

Rank 4 · TkA01G602990 · TK1151

Endoplasmic reticulum0.058

Rank 5 · TkA01G602990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF31004IDM_C46-126 aa

PF04969CS46-137 aa

PF00011HSP2048-151 aa

PF23444DUF712751-92 aa

PF27746Small_heat_shock_put57-136 aa

PF18046FKBP26_C57-79 aa

PF17886ArsA_HSP2058-134 aa

PF21423AhtL-like_1st70-83 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G602990	`PF31004`	IDM_C	46	126	0.00051	20.4
TkA01G602990	`PF04969`	CS	46	137	0.013	17.2
TkA01G602990	`PF00011`	HSP20	48	151	2.5e-32	111.7
TkA01G602990	`PF23444`	DUF7127	51	92	0.0013	19.8
TkA01G602990	`PF27746`	Small_heat_shock_put	57	136	0.00051	20.1
TkA01G602990	`PF18046`	FKBP26_C	57	79	0.0022	18.9
TkA01G602990	`PF17886`	ArsA_HSP20	58	134	5.1e-05	23.5
TkA01G602990	`PF21423`	AhtL-like_1st	70	83	0.065	13.6
TkA01G602990	`PF27175`	YodN_2nd	70	100	0.07	13.6
TkA01G602990	`PF29198`	MglC_N	71	146	0.058	13.6
TkA01G602990	`PF18046`	FKBP26_C	112	138	0.0022	18.9
TkA01G602990	`PF23444`	DUF7127	121	135	0.0013	19.8
TkA01G602990	`PF04969`	CS	131	146	0.013	17.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card