TkA01G601920 | RubberDandelionOmics

Gene overview

TkA01G601920

Reference: TK1151 Chr: Chr01 Coordinates: 151587963-151590590 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2178 bp · TkA01G601920|TK1151|cDNA

CAAGAAGCCCATATGCTAGAAACGTTTCTTCATATTACAAAATACACTGCTATGGATCCTTGGCTCCTTGATTCAATTCCAGTTTTCCCGATTTCGTCGCAACTACAGTGAACAGCTTCGGAAAAAAAAAACACTTCCGGTGAATCAATGGGAATTAAGTAGTGCGAGTTTCCACACCTTCAATCGGACTCTTTGTGCGTTTATTGGTTTTTGTGCTAATTCTGTATTTTGAGTTCCGTTCCTAGTTCTCCTCGGATGTT...

CDS

Download CDS FASTA

1494 bp · TkA01G601920|TK1151|CDS

ATGACCACTCTTCTGATGATTAGCACTCGACCAAATATGATTTACAAAGTGTCATTTGATCATTTCTACAGGACAATGGCTGACACAACTGAAAAAGATGAAACCTCAAAATCAAAGTTAATTCCTGAAAAGGATGTAGATCAATCAGTTATCCCTCCATCGTCTATACTAAGTGATATGGAAGAGGGCGATGAACCTGAAGAAGAAGAGTATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA...

Protein

Download Protein FASTA

497 aa · TkA01G601920|TK1151|PROTEIN

MTTLLMISTRPNMIYKVSFDHFYRTMADTTEKDETSKSKLIPEKDVDQSVIPPSSILSDMEEGDEPEEEEYEEEEEEEEEEEEEEEEYEEEEDEDEEEVEEKETLNDTNEKKDEKKSKEPKEGEELVENSNSKEKKPRLKEKNTKKSTNVANGDKPESSSKKKSSKRVESMGMVFMCSSKTKTDCFRYKVLGLPANKQDQVAKIYKGMRLFLFDVELRLMYGIFKAAGPGGYNIEPKAFKSEFPSQVRFLVLDDCLPIAE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G601920`
TK1151 ID	TkA01G601920
OH-1004 ID	LXL04_000584
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G601920`
Location	Chr01:151587963-151590590 (-)
Description	Similar to B2 protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000584` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009414 response to water deprivation Biological Process GO:0034976 response to endoplasmic reticulum stress Biological Process GO:0043067 regulation of programmed cell death Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:1902074 response to salt Biological Process GO:1904350 regulation of protein catabolic process in the vacuole Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference	ath:AT5G42050 gmx:100808989 gmx:547685 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.966

Rank 1 · TkA01G601920 · TK1151

Cytoplasm0.093

Rank 2 · TkA01G601920 · TK1151

Cell membrane0.036

Rank 3 · TkA01G601920 · TK1151

Endoplasmic reticulum0.019

Rank 4 · TkA01G601920 · TK1151

Plastid0.008

Rank 5 · TkA01G601920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09726Macoilin31-343 aa

PF07133Merozoite_SPAM56-170 aa

PF10486PI3K_1B_p10156-202 aa

PF02724CDC4565-159 aa

PF10539Dev_Cell_Death171-293 aa

PF07133Merozoite_SPAM261-293 aa

PF07133Merozoite_SPAM315-346 aa

PF02724CDC45315-375 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G601920	`PF09726`	Macoilin	31	343	1.2	8.4
TkA01G601920	`PF07133`	Merozoite_SPAM	56	170	0.023	15.4
TkA01G601920	`PF10486`	PI3K_1B_p101	56	202	2.6	6.5
TkA01G601920	`PF02724`	CDC45	65	159	0.56	9.1
TkA01G601920	`PF10539`	Dev_Cell_Death	171	293	3e-46	157.0
TkA01G601920	`PF07133`	Merozoite_SPAM	261	293	0.023	15.4
TkA01G601920	`PF07133`	Merozoite_SPAM	315	346	0.023	15.4
TkA01G601920	`PF02724`	CDC45	315	375	0.56	9.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card