TkA01G597950 | RubberDandelionOmics

Gene overview

TkA01G597950

Reference: TK1151 Chr: Chr01 Coordinates: 150531155-150535909 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1313 bp · TkA01G597950|TK1151|cDNA

TATATATATATATGTACGTATCTATGTATGTATGTATAATGTGTGTAATGTTAATGTAGGTAGGAATATTTGATGCAACAAACAGCACTAGTGAACGGAGGAATATGCTAATGAAGATGGCTGAAGGAAAATGCAAGATCATATTTTTGGAAACAATATGTACTGATCCACAGATTATTGAAAGAAACATACGCCTCAAGATTCAACAGAGTCCTGATTATGCAGAAGAGCCGGATTTTGAAGCTGGATATCAAGACTTC...

CDS

Download CDS FASTA

2115 bp · TkA01G597950|TK1151|CDS

ATGGGAACTGGTTCATCAATTAACCTTGATACCAGCGACGATCACGCCGGTGGTCAACTCTATGTGTCTCTCAAGCTGGAGAGTTACACTCCCAAAGGAGACCTTGTTCCTCACCTCTACGGTTCTGTCCCTCTCGTCGGCTCTTGGGACCCTTCCAAAGCTCTTCCGATGGAGCGAGAGTCATCTTCAACGTGGCAGTTAAGCTTTGTTTCATCTCCTAATCATGACACATTAGACTTCAAGTTCTTACTAAAGTCAAA...

Protein

Download Protein FASTA

704 aa · TkA01G597950|TK1151|PROTEIN

MGTGSSINLDTSDDHAGGQLYVSLKLESYTPKGDLVPHLYGSVPLVGSWDPSKALPMERESSSTWQLSFVSSPNHDTLDFKFLLKSKDTNEQCIVEEGPTRQFTGGTLQGVTRLALFRLTTDEVLEYKVSIKADRVSPFDLAASWRAYQQNLEPSTVRGIPDVSINALPQDSENGMSSSLDLDLEQYVVPTPSTPVVYAANLTENPRSLNNIYNHPPPTIKEKEIGSKVYGMVESKSVGTFSPIEKEGGFVDRGVGSSRL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G597950`
TK1151 ID	TkA01G597950
OH-1004 ID	LXL04_000644
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G597950

Location Chr01:150531155-150535909 (-)

Description Similar to FKFBP: 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g07110`	Synthesis and degradation of fructose 2,6-bisphosphate.	Structure and heterologous expression of a gene encoding fructose-6-phosphate,2-kinase/fructose-2,6-bisphosphatase from Arabidopsis thaliana.2000 · DOI: 10.1016/s0167-4781(00)00134-2 Phosphorylation and 14-3-3 binding of Arabidopsis 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase.2004 · DOI: 10.1111/j.1365-313x.2003.01992.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000644 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006000 fructose metabolic process Biological Process

GO:0006002 fructose 6-phosphate metabolic process Biological Process

GO:0006003 fructose 2,6-bisphosphate metabolic process Biological Process

GO:0006007 glucose catabolic process Biological Process

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0009749 response to glucose Biological Process

GO:0019249 lactate biosynthetic process Biological Process

GO:0032868 response to insulin Biological Process

GO:0033762 response to glucagon Biological Process

GO:0042594 response to starvation Biological Process

GO:0042866 pyruvate biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G07110

hsa:5207

mmu:18639

rno:24638

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.364

Rank 1 · TkA01G597950 · TK1151

Nucleus0.296

Rank 2 · TkA01G597950 · TK1151

Cell membrane0.213

Rank 3 · TkA01G597950 · TK1151

Plastid0.124

Rank 4 · TkA01G597950 · TK1151

Golgi apparatus0.098

Rank 5 · TkA01G597950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00686CBM_2024-105 aa

PF13671AAA_33110-140 aa

PF015916PF2K294-510 aa

PF13671AAA_33305-436 aa

PF08433KTI12305-428 aa

PF00300His_Phos_1513-695 aa

PF13671AAA_33523-567 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G597950	`PF00686`	CBM_20	24	105	3.8e-07	30.5
TkA01G597950	`PF13671`	AAA_33	110	140	2e-06	28.9
TkA01G597950	`PF01591`	6PF2K	294	510	6.9e-82	274.8
TkA01G597950	`PF13671`	AAA_33	305	436	2e-06	28.9
TkA01G597950	`PF08433`	KTI12	305	428	0.18	12.0
TkA01G597950	`PF00300`	His_Phos_1	513	695	5.5e-38	131.3
TkA01G597950	`PF13671`	AAA_33	523	567	2e-06	28.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MB58`	Arabidopsis thaliana	sp\|Q9MB58\|F26_ARATH 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase	72.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card