TkA01G590890 | RubberDandelionOmics

Gene overview

TkA01G590890

Reference: TK1151 Chr: Chr01 Coordinates: 148751514-148754025 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2217 bp · TkA01G590890|TK1151|cDNA

GTAGATGCGAACGTACATGTTTTAATATAAAACTCAGTTACATGGTGACCCTTTGTCATCCACTTAAAATTTTTTTAGACCGTCTCCTCCCATCACCCCCTGACATTAACATATCCATACACTGGTCACCTATATCAAAAGAGGATGTCTTATTCTCGGGTAAACCTTACAAATTATCTTATTCCACTGTATGAGATCATCAGTGCCACCGAAAACTTCAGTCAGGAAAGATGTATCGGAGGCGGTGGATTTGGTTTAGT...

CDS

Download CDS FASTA

1977 bp · TkA01G590890|TK1151|CDS

ATGTCTTATTCTCGGGTAAACCTTACAAATTATCTTATTCCACTGTATGAGATCATCAGTGCCACCGAAAACTTCAGTCAGGAAAGATGTATCGGAGGCGGTGGATTTGGTTTAGTCTACAGAGGGCAACTCTCTGAAAGCTGGAAAAGCCAATCAGTTGCTGTCAAACGGCTAGCTGCAGACAGCCATCAAGGAGAGCATGAGTTCCGCAACGAGCTTGACATTATTTCCAGTTTCCAGCATGAAAACATCATCGCTTT...

Protein

Download Protein FASTA

658 aa · TkA01G590890|TK1151|PROTEIN

MSYSRVNLTNYLIPLYEIISATENFSQERCIGGGGFGLVYRGQLSESWKSQSVAVKRLAADSHQGEHEFRNELDIISSFQHENIIAFIGYCDEGDEMIIVYEYALNGSLNYHLEHRDKISRITWAQRLEICIGAARGLHYLHSGLGEKNKVIHRDIKSANILLDDNMVAKISDFGLSKLHTRNQLDTRFNTKVAGSRYYLDPTYGESGILQKESDIYSFGVVLFEIMSGMLVYRERRTGNEPQLLMNMVRRMERDNIIDP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G590890`
TK1151 ID	TkA01G590890
OH-1004 ID	LXL04_000730
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 98.328 / OH-1004 70.633 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G590890

Location Chr01:148751514-148754025 (-)

Description Similar to PUB13: U-box domain-containing protein 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At2g39360`	Probable receptor-like protein kinase At2g39360.	No verified direct reference in this release
`At5g39000`	Putative receptor-like protein kinase At5g39000.	No verified direct reference in this release
`At5g38990`	Probable receptor-like protein kinase At5g38990.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000730 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G46290

ath:AT3G46510

ath:AT5G59700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.446

Rank 1 · TkA01G590890 · TK1151

Cytoplasm0.415

Rank 2 · TkA01G590890 · TK1151

Nucleus0.291

Rank 3 · TkA01G590890 · TK1151

Endoplasmic reticulum0.040

Rank 4 · TkA01G590890 · TK1151

Golgi apparatus0.036

Rank 5 · TkA01G590890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase26-297 aa

PF07714PK_Tyr_Ser-Thr27-299 aa

PF08998Epsilon_antitox240-259 aa

PF08998Epsilon_antitox283-310 aa

PF05804KAP316-416 aa

PF25598ARM_PUB321-579 aa

PF24768ARM_ARMC5321-497 aa

PF13646HEAT_2324-388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G590890	`PF00069`	Pkinase	26	297	3.7e-44	151.8
TkA01G590890	`PF07714`	PK_Tyr_Ser-Thr	27	299	2.6e-46	158.7
TkA01G590890	`PF08998`	Epsilon_antitox	240	259	0.11	13.6
TkA01G590890	`PF08998`	Epsilon_antitox	283	310	0.11	13.6
TkA01G590890	`PF05804`	KAP	316	416	0.01	14.8
TkA01G590890	`PF25598`	ARM_PUB	321	579	9.8e-25	88.3
TkA01G590890	`PF24768`	ARM_ARMC5	321	497	1.1e-16	61.9
TkA01G590890	`PF13646`	HEAT_2	324	388	5.9e-05	24.0
TkA01G590890	`PF00514`	Arm	351	390	4.9e-24	84.2
TkA01G590890	`PF05804`	KAP	352	431	0.01	14.8
TkA01G590890	`PF02985`	HEAT	363	389	0.042	14.8
TkA01G590890	`PF00514`	Arm	392	430	4.9e-24	84.2
TkA01G590890	`PF13646`	HEAT_2	403	467	5.9e-05	24.0
TkA01G590890	`PF02985`	HEAT	404	431	0.042	14.8
TkA01G590890	`PF00514`	Arm	439	471	4.9e-24	84.2
TkA01G590890	`PF13646`	HEAT_2	440	506	5.9e-05	24.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX66`	Arabidopsis thaliana	sp\|Q9LX66\|HERK_ARATH Receptor-like protein kinase HERK 1	45.500%	Swiss-Prot	Low
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	46.000%	Swiss-Prot	Low
`O80623`	Arabidopsis thaliana	sp\|O80623\|Y2393_ARATH Probable receptor-like protein kinase At2g39360	45.300%	Swiss-Prot	Low
`Q9FID8`	Arabidopsis thaliana	sp\|Q9FID8\|Y5900_ARATH Putative receptor-like protein kinase At5g39000	44.900%	Swiss-Prot	Low
`Q9FID9`	Arabidopsis thaliana	sp\|Q9FID9\|Y5389_ARATH Probable receptor-like protein kinase At5g38990	45.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card