RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G590870
Reference: TK1151 Chr: Chr01 Coordinates: 148734526-148743038 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1500 bp · TkA01G590870|TK1151|cDNA

ATGTCTTCTTCTCCTTCTTCTTCTTCAGTAAACCTACAAAGTTATCTTATTCCACTGGATGAGATCAACCGAGCCACCCACAACTTCAGTCGCGAAAGATATATTGGAGGCGGTGGATTTGGTGGTGTCTACAAAGGACAACTCTCTGAACGCTGGCAAAACCAAATAGTTGCTGTCAAACGGCTAGATGCGGACAGCCGCCAAGGCAACCGCGAGTTCCGCAATGAGCTTCAGATTATTTCCAAATTCCACCATGAAAA...

CDS

Download CDS FASTA

1500 bp · TkA01G590870|TK1151|CDS

ATGTCTTCTTCTCCTTCTTCTTCTTCAGTAAACCTACAAAGTTATCTTATTCCACTGGATGAGATCAACCGAGCCACCCACAACTTCAGTCGCGAAAGATATATTGGAGGCGGTGGATTTGGTGGTGTCTACAAAGGACAACTCTCTGAACGCTGGCAAAACCAAATAGTTGCTGTCAAACGGCTAGATGCGGACAGCCGCCAAGGCAACCGCGAGTTCCGCAATGAGCTTCAGATTATTTCCAAATTCCACCATGAAAA...

Protein

Download Protein FASTA

499 aa · TkA01G590870|TK1151|PROTEIN

MSSSPSSSSVNLQSYLIPLDEINRATHNFSRERYIGGGGFGGVYKGQLSERWQNQIVAVKRLDADSRQGNREFRNELQIISKFHHENIITFIGYCDEGGEMIIVYTYASEGSLDHHLQYPNKMSRITWVQRLEICIGATRGLHYLHSGLGEQDRVIHRDVKSANILLNDNMVAKICDFGLSKLGTRNKPDTQGYTKVAGTQFYLDPSYLESGILQKESDVYSFGVVLFEILSGMLVYSERRIGDERQPLMNSVRRFHENE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G590870
TK1151 IDTkA01G590870
OH-1004 IDLXL04_000723
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)56.000
Protein coverage (%)TK1151 96.994 / OH-1004 91.958
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G590870
LocationChr01:148734526-148743038 (-)
DescriptionSimilar to PUB13: U-box domain-containing protein 13
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g59700 Probable receptor-like protein kinase At5g59700. No verified direct reference in this release
At3g46290 Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.
Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
At2g39360 Probable receptor-like protein kinase At2g39360. No verified direct reference in this release
At5g28680 Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell. No verified direct reference in this release
At5g39000 Putative receptor-like protein kinase At5g39000. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000723 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0007166 cell surface receptor signaling pathway Biological Process
GO:0009741 response to brassinosteroid Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0009908 flower development Biological Process
GO:0010183 pollen tube guidance Biological Process
GO:0010483 pollen tube reception Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0031348 negative regulation of defense response Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0043069 negative regulation of programmed cell death Biological Process
GO:0048586 regulation of long-day photoperiodism, flowering Biological Process
KEGG gene cross-reference
ath:AT2G28830
ath:AT3G46290
ath:AT3G46510
dosa:Os12g0570000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.582
Rank 1 · TkA01G590870 · TK1151
Nucleus0.347
Rank 2 · TkA01G590870 · TK1151
Cell membrane0.223
Rank 3 · TkA01G590870 · TK1151
Endoplasmic reticulum0.048
Rank 4 · TkA01G590870 · TK1151
Mitochondrion0.043
Rank 5 · TkA01G590870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase30-271 aa
PF07714PK_Tyr_Ser-Thr32-239 aa
PF01636APH151-185 aa
PF11698V-ATPase_H_C290-359 aa
PF13646HEAT_2301-357 aa
PF24768ARM_ARMC5321-443 aa
PF00514Arm322-360 aa
PF25598ARM_PUB340-459 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G590870PF00069Pkinase302712.3e-44152.5
TkA01G590870PF07714PK_Tyr_Ser-Thr322395e-44151.3
TkA01G590870PF01636APH1511850.1512.5
TkA01G590870PF11698V-ATPase_H_C2903590.01216.4
TkA01G590870PF13646HEAT_23013570.0714.1
TkA01G590870PF24768ARM_ARMC53214430.01515.4
TkA01G590870PF00514Arm3223603.1e-0834.1
TkA01G590870PF25598ARM_PUB3404591.3e-0525.5
TkA01G590870PF00514Arm4044243.1e-0834.1
TkA01G590870PF13646HEAT_24084260.0714.1
TkA01G590870PF10057MpsC4264800.01616.0
TkA01G590870PF13646HEAT_24294490.0714.1
TkA01G590870PF11698V-ATPase_H_C4694850.01216.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FN92Arabidopsis thalianasp|Q9FN92|Y5597_ARATH Probable receptor-like protein kinase At5g5970052.300%Swiss-ProtLow
Q9LX66Arabidopsis thalianasp|Q9LX66|HERK_ARATH Receptor-like protein kinase HERK 152.500%Swiss-ProtLow
O80623Arabidopsis thalianasp|O80623|Y2393_ARATH Probable receptor-like protein kinase At2g3936051.100%Swiss-ProtLow
Q3E8W4Arabidopsis thalianasp|Q3E8W4|ANX2_ARATH Receptor-like protein kinase ANXUR250.500%Swiss-ProtLow
Q9FID8Arabidopsis thalianasp|Q9FID8|Y5900_ARATH Putative receptor-like protein kinase At5g3900049.800%Swiss-ProtLow

JBrowse

View in Genome Browser