TkA01G588310 | RubberDandelionOmics

Gene overview

TkA01G588310

Reference: TK1151 Chr: Chr01 Coordinates: 147995788-147996546 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

720 bp · TkA01G588310|TK1151|cDNA

ATGGCGTTTCTCAACCGAAATCCTTCGCTCTGTGTTCTCGTGCTAATCTTCGCATCTCTGGTGTTTCTAACCTCGCCGGTGCATTCTCTCAACTGCTCATCGCAGAAGTTCACCAACAGCAAGCTATACAGCAAGTGCATCGATCTACCAACACTCGGCGCATCGCTCCACTGGACTCACATCGCCGAAAACTCCTCCCTCTCAATCGCATTCATCGCGCCTCCCGCTAAGCCGGACGGATGGATCGCGTGGGCTATTAA...

CDS

Download CDS FASTA

720 bp · TkA01G588310|TK1151|CDS

ATGGCGTTTCTCAACCGAAATCCTTCGCTCTGTGTTCTCGTGCTAATCTTCGCATCTCTGGTGTTTCTAACCTCGCCGGTGCATTCTCTCAACTGCTCATCGCAGAAGTTCACCAACAGCAAGCTATACAGCAAGTGCATCGATCTACCAACACTCGGCGCATCGCTCCACTGGACTCACATCGCCGAAAACTCCTCCCTCTCAATCGCATTCATCGCGCCTCCCGCTAAGCCGGACGGATGGATCGCGTGGGCTATTAA...

Protein

Download Protein FASTA

239 aa · TkA01G588310|TK1151|PROTEIN

MAFLNRNPSLCVLVLIFASLVFLTSPVHSLNCSSQKFTNSKLYSKCIDLPTLGASLHWTHIAENSSLSIAFIAPPAKPDGWIAWAINPTQTGMAGSQALVAFKDSNGSMAVKTYNISSYSSIVEGKISLDVSESIAEYSDKSMKIFATVKLPKTMTEVNHVWQVGGLVKGGMPGKHEFLPANLKSMGKLQLPMSENAQSNGTTTVGSPSIAPSTPTNSASRNTVMYALFLLVVSVLILN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G588310`
TK1151 ID	TkA01G588310
OH-1004 ID	LXL04_000785
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	93.500
Protein coverage (%)	TK1151 97.490 / OH-1004 51.464 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G588310

Location Chr01:147995788-147996546 (+)

Description Similar to ALP1: Protein ANTAGONIST OF LIKE HETEROCHROMATIN PROTEIN 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g25290`	May act as a catecholamine-responsive trans-membrane electron transporter.	No verified direct reference in this release
`At4g12980`	May act as a catecholamine-responsive trans-membrane electron transporter.	No verified direct reference in this release
`At3g07390`	One-heme-containing cytochrome.	Auxin-responsive genes AIR12 code for a new family of plasma membrane b-type cytochromes specific to flowering plants.2009 · DOI: 10.1104/pp.109.139170
`At5g47530`	May act as a catecholamine-responsive trans-membrane electron transporter.	No verified direct reference in this release
`At4g17280`	May act as a catecholamine-responsive trans-membrane electron transporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000785 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0030198 extracellular matrix organization Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0080022 primary root development Biological Process

GO:0000118 histone deacetylase complex Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G07390

ath:AT3G25290

ath:AT3G55350

ath:AT3G63270

ath:AT4G12980

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.778

Rank 1 · TkA01G588310 · TK1151

Cytoplasm0.089

Rank 2 · TkA01G588310 · TK1151

Endoplasmic reticulum0.088

Rank 3 · TkA01G588310 · TK1151

Extracellular0.075

Rank 4 · TkA01G588310 · TK1151

Lysosome / Vacuole0.053

Rank 5 · TkA01G588310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19325RNF152_C9-39 aa

PF03351DOMON55-151 aa

PF04526DUF56893-191 aa

PF19325RNF152_C106-132 aa

PF04526DUF568201-223 aa

PF19325RNF152_C223-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G588310	`PF19325`	RNF152_C	9	39	0.15	13.2
TkA01G588310	`PF03351`	DOMON	55	151	0.00047	21.1
TkA01G588310	`PF04526`	DUF568	93	191	2.5e-32	112.3
TkA01G588310	`PF19325`	RNF152_C	106	132	0.15	13.2
TkA01G588310	`PF04526`	DUF568	201	223	2.5e-32	112.3
TkA01G588310	`PF19325`	RNF152_C	223	236	0.15	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSE7`	Arabidopsis thaliana	sp\|Q9LSE7\|B561C_ARATH Cytochrome b561 and DOMON domain-containing protein At3g25290	51.900%	Swiss-Prot	High
`Q9SV71`	Arabidopsis thaliana	sp\|Q9SV71\|B561O_ARATH Cytochrome b561 and DOMON domain-containing protein At4g12980	48.600%	Swiss-Prot	Medium
`Q94BT2`	Arabidopsis thaliana	sp\|Q94BT2\|AIR12_ARATH Auxin-induced in root cultures protein 12	48.600%	Swiss-Prot	Medium
`Q9FGK4`	Arabidopsis thaliana	sp\|Q9FGK4\|B561J_ARATH Cytochrome b561 and DOMON domain-containing protein At5g47530	36.800%	Swiss-Prot	Medium
`Q8VYH6`	Arabidopsis thaliana	sp\|Q8VYH6\|B651B_ARATH Cytochrome b561 and DOMON domain-containing protein At4g17280	34.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card