TkA01G580350 | RubberDandelionOmics

Gene overview

TkA01G580350

Reference: TK1151 Chr: Chr01 Coordinates: 146021453-146023131 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1037 bp · TkA01G580350|TK1151|cDNA

GAAATGGCTTAAGGCGGGTACTGTCCTTTACTAGTAGCCTAGTACAAAACTCCACCCCATCCTTCCGAACCATTCCCAAACGAGATCTCTCGTCTCTCTCTCCAACTTCAGAGAGATATGAGTACAGCAATTTCTTTACCAGCTGTGTATACTCGTATTCCGTCGAACACCCAAATCGTTAGAGCCGCCAGTTCGTCGTTTTCTGCGTCTATCGCCCTTAAATCCACAAACAATCGGCATGGCAAGGGAGCAGTAGGTAC...

CDS

Download CDS FASTA

606 bp · TkA01G580350|TK1151|CDS

ATGAGTACAGCAATTTCTTTACCAGCTGTGTATACTCGTATTCCGTCGAACACCCAAATCGTTAGAGCCGCCAGTTCGTCGTTTTCTGCGTCTATCGCCCTTAAATCCACAAACAATCGGCATGGCAAGGGAGCAGTAGGTACCTTGTCGCAGAAGAAATTGGTTCTTCCGAGACATCGTTCTAGGTGCAAGTGTAGCAGCACACCCGGCGGCCCTGTTCCTGGTGAAAATGAAAGTAAACAAGTATTGGATGCATTTTT...

Protein

Download Protein FASTA

201 aa · TkA01G580350|TK1151|PROTEIN

MSTAISLPAVYTRIPSNTQIVRAASSSFSASIALKSTNNRHGKGAVGTLSQKKLVLPRHRSRCKCSSTPGGPVPGENESKQVLDAFFLGKAFAEALNERVESAVGEFLSTVGRLQSEQQKQVQEFQDEVVERAKKAKDKAAREAMEAQGLVPKSAPSSVSSPIIAIDEVTISPSSSTQDSKDQGPGNDTSTEPLSETSIDD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G580350`
TK1151 ID	TkA01G580350
OH-1004 ID	LXL04_000855
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.900
Protein coverage (%)	TK1151 100.000 / OH-1004 79.851 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G580350

Location Chr01:146021453-146023131 (+)

Description Similar to At4g13200: Uncharacterized protein At4g13200, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13200`	Uncharacterized protein At4g13200, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000855 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010027 thylakoid membrane organization Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0031969 chloroplast membrane Cellular Component

KEGG gene cross-reference

ath:AT4G13200

syn:sll1769

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.978

Rank 1 · TkA01G580350 · TK1151

Mitochondrion0.027

Rank 2 · TkA01G580350 · TK1151

Nucleus0.026

Rank 3 · TkA01G580350 · TK1151

Cytoplasm0.019

Rank 4 · TkA01G580350 · TK1151

Cell membrane0.011

Rank 5 · TkA01G580350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20711DUF682579-178 aa

PF01442Apolipoprotein93-148 aa

PF11458Mistic94-110 aa

PF25041UFL1_C107-144 aa

PF05680ATP-synt_E113-154 aa

PF11458Mistic116-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G580350	`PF20711`	DUF6825	79	178	7.8e-34	117.0
TkA01G580350	`PF01442`	Apolipoprotein	93	148	0.013	16.0
TkA01G580350	`PF11458`	Mistic	94	110	0.16	12.8
TkA01G580350	`PF25041`	UFL1_C	107	144	0.099	13.2
TkA01G580350	`PF05680`	ATP-synt_E	113	154	0.11	13.3
TkA01G580350	`PF11458`	Mistic	116	145	0.16	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LDV3`	Arabidopsis thaliana	sp\|Q8LDV3\|Y4320_ARATH Uncharacterized protein At4g13200, chloroplastic	54.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card