TkA01G579410 | RubberDandelionOmics

Gene overview

TkA01G579410

Reference: TK1151 Chr: Chr01 Coordinates: 145794052-145796833 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

348 bp · TkA01G579410|TK1151|cDNA

ATGGTGTATGACTTCAAAAAAAACCTTATTAAAGGTAATGATCAATTAAAAGACACCTTTTGGGAAACGATACGGAAAAGGTTTTTTGACATCTTGAAGCGTACACCGAATCGGAACACCGATGGTTTAAGTAGCAAATGGCGAGACTTGTCAAAAAAGTGTACGAAGTTCAACGTAATCTACACTAACATTGAAAATCAAAAACCAAGTGGGTGGAACGAGATGAACTACTTGCTAGCGGCAAAATCACAATACCGGGC...

CDS

Download CDS FASTA

348 bp · TkA01G579410|TK1151|CDS

ATGGTGTATGACTTCAAAAAAAACCTTATTAAAGGTAATGATCAATTAAAAGACACCTTTTGGGAAACGATACGGAAAAGGTTTTTTGACATCTTGAAGCGTACACCGAATCGGAACACCGATGGTTTAAGTAGCAAATGGCGAGACTTGTCAAAAAAGTGTACGAAGTTCAACGTAATCTACACTAACATTGAAAATCAAAAACCAAGTGGGTGGAACGAGATGAACTACTTGCTAGCGGCAAAATCACAATACCGGGC...

Protein

Download Protein FASTA

115 aa · TkA01G579410|TK1151|PROTEIN

MVYDFKKNLIKGNDQLKDTFWETIRKRFFDILKRTPNRNTDGLSSKWRDLSKKCTKFNVIYTNIENQKPSGWNEMNYLLAAKSQYRATEGQDFTHEKVWQRVRHEQKWLSQETLE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G579410`
TK1151 ID	TkA01G579410
OH-1004 ID	LXL04_022192
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	88.900
Protein coverage (%)	TK1151 86.087 / OH-1004 14.348 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G579410`
Location	Chr01:145794052-145796833 (-)
Description	Similar to At3g03920: Putative H/ACA ribonucleoprotein complex subunit 1-like protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022192` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000454 snoRNA guided rRNA pseudouridine synthesis Biological Process GO:0031120 snRNA pseudouridine synthesis Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0009535 chloroplast thylakoid membrane Cellular Component GO:0010494 cytoplasmic stress granule Cellular Component GO:0031429 box H/ACA snoRNP complex Cellular Component GO:0003729 mRNA binding Molecular Function GO:0034513 box H/ACA snoRNA binding Molecular Function GO:0042802 identical protein binding Molecular Function
KEGG gene cross-reference	ath:AT3G03920 ath:AT5G18180 kla:KLLA0_F21604g pic:PICST_75322 sce:YHR089C These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.921

Rank 1 · TkA01G579410 · TK1151

Cytoplasm0.086

Rank 2 · TkA01G579410 · TK1151

Extracellular0.030

Rank 3 · TkA01G579410 · TK1151

Mitochondrion0.016

Rank 4 · TkA01G579410 · TK1151

Cell membrane0.012

Rank 5 · TkA01G579410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27212BrxC_7th14-36 aa

PF08953DUF189944-70 aa

PF27212BrxC_7th45-62 aa

PF08953DUF189982-106 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G579410	`PF27212`	BrxC_7th	14	36	0.2	12.4
TkA01G579410	`PF08953`	DUF1899	44	70	0.063	13.9
TkA01G579410	`PF27212`	BrxC_7th	45	62	0.2	12.4
TkA01G579410	`PF08953`	DUF1899	82	106	0.063	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card