TkA01G566540 | RubberDandelionOmics

Gene overview

TkA01G566540

Reference: TK1151 Chr: Chr01 Coordinates: 142586288-142590199 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3413 bp · TkA01G566540|TK1151|cDNA

TCCCTTTCCAATAAAAAATTGTTATTTTCCATTTCTACTCTCTATCTTAGAAGTTAGAAGCACGATATGTACCCCACCAATCACTATGTAATTCACTTTTGGCAGTAATTTTCTTCTTTGAACGAAAAAGCAAACTTGTCATTAACAAAGCCAATCTTGGTATGACGCATTAAACACTTGTACTCTTTGCTGGCACCAATAAATTCTTGTTCTCTTTTATATTCCCCCAACCCATCAACGAACAACATAGCATGAGCTGC...

CDS

Download CDS FASTA

987 bp · TkA01G566540|TK1151|CDS

ATGAAGACGTTCTTTCCATCCGAATCTTGTAAAGAAACACACTTGAATGCTTTGAATCCTCAATCATGGCTGCAAGTCGAAAGAGGAAAGCTTTCAAAAGTCTCACCTCACTCCCCTTCTTCATTAGAATCACTAATCAAAGTACCTGATCCACCAATTCTTCCATTCTTTAAACCCGTTGATTATGTAGAAGTTTTAGCACAAATCCACAAAGAACTCGAATCATGCCCGCCACATCAGCGATCAAGCCTCTATTTGTT...

Protein

Download Protein FASTA

328 aa · TkA01G566540|TK1151|PROTEIN

MKTFFPSESCKETHLNALNPQSWLQVERGKLSKVSPHSPSSLESLIKVPDPPILPFFKPVDYVEVLAQIHKELESCPPHQRSSLYLLQFQVFKGLGDLKLMRRSLRSAWIKSITVHERLVFGAWLKYEKRGEELISDLLSSCGKCAKEFGLIDIGSELPSVANDDSVTNDAMTNLNTNYLSETVSFRIRGEKVKCDRQKMAALSPPFHSMLNGCFLESLSDIIDLSKNDISPAGMRVISAFSKTGTLPDTIPTDLLLEIM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G566540`
TK1151 ID	TkA01G566540
OH-1004 ID	LXL04_001017
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.800
Protein coverage (%)	TK1151 95.122 / OH-1004 31.869 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G566540

Location Chr01:142586288-142590199 (+)

Description Similar to EOL1: ETO1-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02680`	Possible regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001017 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0010364 regulation of ethylene biosynthetic process Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0017145 stem cell division Biological Process

GO:0035864 response to potassium ion Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0046683 response to organophosphorus Biological Process

GO:2000069 regulation of post-embryonic root development Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G51770

ath:AT4G02680

ath:AT5G58550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.520

Rank 1 · TkA01G566540 · TK1151

Cytoplasm0.435

Rank 2 · TkA01G566540 · TK1151

Mitochondrion0.110

Rank 3 · TkA01G566540 · TK1151

Cell membrane0.042

Rank 4 · TkA01G566540 · TK1151

Endoplasmic reticulum0.034

Rank 5 · TkA01G566540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30484ETO1_C59-129 aa

PF30481ETO1_N63-150 aa

PF00651BTB183-280 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G566540	`PF30484`	ETO1_C	59	129	0.089	12.7
TkA01G566540	`PF30481`	ETO1_N	63	150	1.1e-49	167.0
TkA01G566540	`PF00651`	BTB	183	280	0.00069	20.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQX6`	Arabidopsis thaliana	sp\|Q9ZQX6\|ETOL1_ARATH ETO1-like protein 1	55.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card