TkA01G565010 | RubberDandelionOmics

Gene overview

TkA01G565010

Reference: TK1151 Chr: Chr01 Coordinates: 142159111-142159749 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

600 bp · TkA01G565010|TK1151|cDNA

ATGCCGACAACCTTTGAACGGAATCTCAATCTATGCTTCTCCAAAATCAAACGCTCACAATCACCACCAGCAACTCCTCCTCCACCTCCTCACCGCCACAACAATCACCGCCACCGTCGCCGCCACTCCGAACCCGTCGTACAAAATCCCAAATCTAACCTCATCAATTCCGACGATTCATCAATCACCACCACCGCCCCTGATTTCTCCACCGCCATCGCTTCTAATCGCTTCTTTTTCTCCTCCCCCGGCCGCTCCAA...

CDS

Download CDS FASTA

600 bp · TkA01G565010|TK1151|CDS

ATGCCGACAACCTTTGAACGGAATCTCAATCTATGCTTCTCCAAAATCAAACGCTCACAATCACCACCAGCAACTCCTCCTCCACCTCCTCACCGCCACAACAATCACCGCCACCGTCGCCGCCACTCCGAACCCGTCGTACAAAATCCCAAATCTAACCTCATCAATTCCGACGATTCATCAATCACCACCACCGCCCCTGATTTCTCCACCGCCATCGCTTCTAATCGCTTCTTTTTCTCCTCCCCCGGCCGCTCCAA...

Protein

Download Protein FASTA

199 aa · TkA01G565010|TK1151|PROTEIN

MPTTFERNLNLCFSKIKRSQSPPATPPPPPHRHNNHRHRRRHSEPVVQNPKSNLINSDDSSITTTAPDFSTAIASNRFFFSSPGRSNSIIESSSPSTSSLASTSFTPEHAATGFVGGGVAIPTISPDPYFDFRKSMQEMVEARDLIDVRANWDYLHELLTCYLDLNPKSAHKFIVGAFADLLVTLMDSSTAENGRRRNV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G565010`
TK1151 ID	TkA01G565010
OH-1004 ID	LXL04_001041
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	81.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G565010

Location Chr01:142159111-142159749 (-)

Description Similar to OFP16: Transcription repressor OFP16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14860`	Transcriptional repressor that may regulate multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At2g32100`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896
`At1g05420`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At1g79960`	Transcriptional repressor that may regulate multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At2g36050`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001041 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G05420

ath:AT1G79960

ath:AT2G32100

ath:AT4G14860

ath:AT5G04820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.395

Rank 1 · TkA01G565010 · TK1151

Cytoplasm0.384

Rank 2 · TkA01G565010 · TK1151

Cell membrane0.326

Rank 3 · TkA01G565010 · TK1151

Endoplasmic reticulum0.074

Rank 4 · TkA01G565010 · TK1151

Plastid0.040

Rank 5 · TkA01G565010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15251TAPR1-like26-112 aa

PF04844Ovate125-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G565010	`PF15251`	TAPR1-like	26	112	0.2	12.1
TkA01G565010	`PF04844`	Ovate	125	185	5.9e-24	84.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23341`	Arabidopsis thaliana	sp\|O23341\|OFP11_ARATH Transcription repressor OFP11	61.500%	Swiss-Prot	Low
`Q9SKY9`	Arabidopsis thaliana	sp\|Q9SKY9\|OFP16_ARATH Transcription repressor OFP16	40.400%	Swiss-Prot	Medium
`F4I8R6`	Arabidopsis thaliana	sp\|F4I8R6\|OFP12_ARATH Transcription repressor OFP12	45.900%	Swiss-Prot	Medium
`Q9S7T5`	Arabidopsis thaliana	sp\|Q9S7T5\|OFP14_ARATH Transcription repressor OFP14	44.300%	Swiss-Prot	Low
`Q9SJ45`	Arabidopsis thaliana	sp\|Q9SJ45\|OPF15_ARATH Transcription repressor OFP15	37.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card