TkA01G564400 | RubberDandelionOmics

Gene overview

TkA01G564400

Reference: TK1151 Chr: Chr01 Coordinates: 141940644-141943653 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1970 bp · TkA01G564400|TK1151|cDNA

CAAACTGTCTCCAAGGGTTTCATGCCTGCCACCGTCACCTTTTCGCGGCAACAAAAGAGTAATAAGGGGTACCGGACGTTTATCCACCGGTTTTTTCCCTCGTCTCCATCACCTTCTTGAAAGGATAGTTAGATATGGAGTCAAATCACGGTAACATGCGCTCAATCAAGCTATGGCCTCCGAGCCAAATCACGAGGCAAGTTCTTGTGGATCGTATAGTAAAAAACCTGGCATCCCCATCCATTCTCTCAAGAAAATAC...

CDS

Download CDS FASTA

1560 bp · TkA01G564400|TK1151|CDS

ATGGAGTCAAATCACGGTAACATGCGCTCAATCAAGCTATGGCCTCCGAGCCAAATCACGAGGCAAGTTCTTGTGGATCGTATAGTAAAAAACCTGGCATCCCCATCCATTCTCTCAAGAAAATACGGTCTCTTAAGTAAAGAAGAAGCAGAAGAAGACGCTAAATTAATCGAATCCGCCGCCTTCGTTGCCGCCAGTCAATACTTTGACAAAGACCCAGATAACGATGGAGGATCCGCCGTACAACTCTACGCTAAAGA...

Protein

Download Protein FASTA

519 aa · TkA01G564400|TK1151|PROTEIN

MESNHGNMRSIKLWPPSQITRQVLVDRIVKNLASPSILSRKYGLLSKEEAEEDAKLIESAAFVAASQYFDKDPDNDGGSAVQLYAKESSKLMVEVIKKGSRGKDDREILPELVAFTSDHETVFDISGGRRAYIEAEEARELLKPLKESGTKYTKICFSNRSFGLPAGHVAASILSSIKDQLTDVDLSDIVSRRPEPEAVEVMKMFSSALEGSNLNTLNLSNNSLGERGIRAFGDLLKSQKNLVGLYLMNAGISEHAAKAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G564400`
TK1151 ID	TkA01G564400
OH-1004 ID	LXL04_001054
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.651 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G564400

Location Chr01:141940644-141943653 (-)

Description Similar to RANGAP1: RAN GTPase-activating protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19320`	GTPase activator for the nuclear Ras-related regulatory protein Ran, converting it to the putatively inactive GDP-bound state.	No verified direct reference in this release
`At3g63130`	GTPase activator for the nuclear Ras-related regulatory protein Ran, converting it to the putatively inactive GDP-bound state.	Plant RanGAPs are localized at the nuclear envelope in interphase and associated with microtubules in mitotic cells.2002 · DOI: 10.1046/j.1365-313x.2002.01324.x RanGAP1 is a continuous marker of the Arabidopsis cell division plane.2008 · DOI: 10.1073/pnas.0806157105
`At1g47200`	Regulates the mitotic activity in roots.	Arabidopsis WPP-domain proteins are developmentally associated with the nuclear envelope and promote cell division.2004 · DOI: 10.1105/tpc.104.026740 WPP-domain proteins mimic the activity of the HSC70-1 chaperone in preventing mistargeting of RanGAP1-anchoring protein WIT1.2009 · DOI: 10.1104/pp.109.143404
`At5g43070`	Regulates the mitotic activity in roots.	Arabidopsis WPP-domain proteins are developmentally associated with the nuclear envelope and promote cell division.2004 · DOI: 10.1105/tpc.104.026740 WPP-domain proteins mimic the activity of the HSC70-1 chaperone in preventing mistargeting of RanGAP1-anchoring protein WIT1.2009 · DOI: 10.1104/pp.109.143404

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001054 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0007249 canonical NF-kappaB signal transduction Biological Process

GO:0032687 negative regulation of interferon-alpha production Biological Process

GO:0032688 negative regulation of interferon-beta production Biological Process

GO:0032715 negative regulation of interleukin-6 production Biological Process

GO:0032720 negative regulation of tumor necrosis factor production Biological Process

GO:0043124 negative regulation of canonical NF-kappaB signal transduction Biological Process

GO:0045824 negative regulation of innate immune response Biological Process

GO:0048147 negative regulation of fibroblast proliferation Biological Process

GO:0050680 negative regulation of epithelial cell proliferation Biological Process

KEGG gene cross-reference

ath:AT3G63130

ath:AT5G19320

hsa:197358

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.537

Rank 1 · TkA01G564400 · TK1151

Nucleus0.509

Rank 2 · TkA01G564400 · TK1151

Cell membrane0.052

Rank 3 · TkA01G564400 · TK1151

Mitochondrion0.051

Rank 4 · TkA01G564400 · TK1151

Endoplasmic reticulum0.032

Rank 5 · TkA01G564400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13943WPP10-104 aa

PF29265LRR_CARMIL104-187 aa

PF29247LRR_MHP1-HER1-GIP3149-299 aa

PF13407Peripla_BP_4195-262 aa

PF29265LRR_CARMIL210-436 aa

PF24048LRR_NXF1-5210-224 aa

PF29255LRR_NLRC3212-438 aa

PF27087LRR_TMOD-LMOD212-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G564400	`PF13943`	WPP	10	104	6.1e-34	117.3
TkA01G564400	`PF29265`	LRR_CARMIL	104	187	4.6e-16	59.3
TkA01G564400	`PF29247`	LRR_MHP1-HER1-GIP3	149	299	2.5e-05	24.4
TkA01G564400	`PF13407`	Peripla_BP_4	195	262	0.21	11.8
TkA01G564400	`PF29265`	LRR_CARMIL	210	436	4.6e-16	59.3
TkA01G564400	`PF24048`	LRR_NXF1-5	210	224	0.36	11.2
TkA01G564400	`PF29255`	LRR_NLRC3	212	438	2.8e-44	152.2
TkA01G564400	`PF27087`	LRR_TMOD-LMOD	212	332	1.3e-12	48.3
TkA01G564400	`PF13855`	LRR_8	212	232	0.0011	19.4
TkA01G564400	`PF13516`	LRR_6	213	232	1.2e-13	50.7
TkA01G564400	`PF00560`	LRR_1	213	235	7.5e-10	37.7
TkA01G564400	`PF12799`	LRR_4	213	249	2.3e-08	34.7
TkA01G564400	`PF29252`	LRR_NLRC4	225	342	1.6e-08	34.9
TkA01G564400	`PF18273`	T3RM_EcoP15I_C	245	272	0.094	13.7
TkA01G564400	`PF24048`	LRR_NXF1-5	255	283	0.36	11.2
TkA01G564400	`PF12799`	LRR_4	266	278	2.3e-08	34.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M651`	Arabidopsis thaliana	sp\|Q9M651\|RAGP2_ARATH RAN GTPase-activating protein 2	61.000%	Swiss-Prot	High
`Q9LE82`	Arabidopsis thaliana	sp\|Q9LE82\|RAGP1_ARATH RAN GTPase-activating protein 1	66.000%	Swiss-Prot	High
`Q9C500`	Arabidopsis thaliana	sp\|Q9C500\|WPP2_ARATH WPP domain-containing protein 2	41.800%	Swiss-Prot	Low
`Q9FMH6`	Arabidopsis thaliana	sp\|Q9FMH6\|WPP1_ARATH WPP domain-containing protein 1	40.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card