TkA01G556990 | RubberDandelionOmics

Gene overview

TkA01G556990

Reference: TK1151 Chr: Chr01 Coordinates: 140042824-140047222 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3226 bp · TkA01G556990|TK1151|cDNA

ATATAATGCAAAGAAAATAAAACATCGAAATTTGTTACCCTATTTTTTAGGGGTTTTATTTGAGCCCAAGTTTTTTGGACGGGGAGAGTGAATCTCCCCGAAACACGAGTGGGCCTTGACCGTGAGGTATATCAGTATATGCGAATGCGACCGACTACAATGCATCACACACGTGAAGGCGATACAGATGTCAATCAATACGCCACGACAGAATGGCTGGCGGTTTGATATTTTACACAGCCTAGAAACATCCATATTCT...

CDS

Download CDS FASTA

2553 bp · TkA01G556990|TK1151|CDS

ATGTCAATCAATACGCCACGACAGAATGGCTGGCGGTTTGATATTTTACACAGCCTAGAAACATCCATATTCTTCGTCAACTTACTGAAATTTGGATCCATGGTGACACCTAAGTTTACAAGAGTCCCAAGTATGCGAGAGCGGGTTCAAGAAACTCTCTCCGCTCACCGCAACGAGATCGTCTCTCTTCTTTCCAGGTATGTAGATCAGGGGAAGGGCATTTTGCAGCCACACCACCTTCTCGACGAGATTGAGAATAC...

Protein

Download Protein FASTA

850 aa · TkA01G556990|TK1151|PROTEIN

MSINTPRQNGWRFDILHSLETSIFFVNLLKFGSMVTPKFTRVPSMRERVQETLSAHRNEIVSLLSRYVDQGKGILQPHHLLDEIENTIGDHASRQKLTDSPFGEILKSAQEGIILPPYVALAVRPRPGVWEFLRVNVNELSIEQLSVSEYLVFKEELVDGQSKSPFVLELDLEPFNATFPRMSRSSSIGNGVLFLNRHLSSLMFRDKDCMEPLLDFLRAHKHKGYGMMLNDRIQNISRLESCLAKAEDYLSKQPPDTAYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G556990`
TK1151 ID	TkA01G556990
OH-1004 ID	LXL04_001165
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G556990

Location Chr01:140042824-140047222 (+)

Description Similar to SUS2: Sucrose synthase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02280`	Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways.	Arabidopsis sucrose synthase 2 and 3 modulate metabolic homeostasis and direct carbon towards starch synthesis in developing seeds.2010 · DOI: 10.1007/s00425-010-1207-9
`At5g49190`	Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways.	Arabidopsis sucrose synthase 2 and 3 modulate metabolic homeostasis and direct carbon towards starch synthesis in developing seeds.2010 · DOI: 10.1007/s00425-010-1207-9 Regulation of AtSUS2 and AtSUS3 by glucose and the transcription factor LEC2 in different tissues and at different stages of Arabidopsis seed development.2012 · DOI: 10.1007/s11103-011-9871-0

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0340500`	Sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001165 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0005982 starch metabolic process Biological Process

GO:0005985 sucrose metabolic process Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0010431 seed maturation Biological Process

GO:0010555 response to mannitol Biological Process

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0042170 plastid membrane Cellular Component

GO:0016157 sucrose synthase activity Molecular Function

KEGG gene cross-reference

ath:AT4G02280

ath:AT5G49190

dosa:Os03g0340500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.532

Rank 1 · TkA01G556990 · TK1151

Nucleus0.269

Rank 2 · TkA01G556990 · TK1151

Mitochondrion0.123

Rank 3 · TkA01G556990 · TK1151

Peroxisome0.083

Rank 4 · TkA01G556990 · TK1151

Plastid0.067

Rank 5 · TkA01G556990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24861SUS_N42-155 aa

PF19233DUF5886188-237 aa

PF24862SUS_EPBD190-277 aa

PF00862GT-B_Sucrose_synth300-588 aa

PF20706GT4-conflict370-410 aa

PF00534Glycos_transf_1609-771 aa

PF20706GT4-conflict609-756 aa

PF13692Glyco_trans_1_4613-767 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G556990	`PF24861`	SUS_N	42	155	1.7e-48	164.2
TkA01G556990	`PF19233`	DUF5886	188	237	0.25	12.3
TkA01G556990	`PF24862`	SUS_EPBD	190	277	4e-32	111.2
TkA01G556990	`PF00862`	GT-B_Sucrose_synth	300	588	2.3e-167	555.8
TkA01G556990	`PF20706`	GT4-conflict	370	410	4.9e-05	23.2
TkA01G556990	`PF00534`	Glycos_transf_1	609	771	6e-27	95.0
TkA01G556990	`PF20706`	GT4-conflict	609	756	4.9e-05	23.2
TkA01G556990	`PF13692`	Glyco_trans_1_4	613	767	2.6e-13	51.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M111`	Arabidopsis thaliana	sp\|Q9M111\|SUS3_ARATH Sucrose synthase 3	78.400%	Swiss-Prot	High
`Q00917`	Arabidopsis thaliana	sp\|Q00917\|SUS2_ARATH Sucrose synthase 2	73.800%	Swiss-Prot	High
`Q10LP5`	Oryza sativa subsp. japonica	sp\|Q10LP5\|SUS4_ORYSJ Sucrose synthase 4	75.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card