TkA01G546050 | RubberDandelionOmics

Gene overview

TkA01G546050

Reference: TK1151 Chr: Chr01 Coordinates: 137100291-137101985 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1141 bp · TkA01G546050|TK1151|cDNA

AAAACGTTGTGTATTTCCATTTAACTTAAGAAAATGATAAGATATGACTCCAAAAGATTCATATTAAGTATTAACTATTTAGTTAATAACTCGATAAACATGAGAGGACCGTCCTTGTAAATTCACTTCGATTTTATTCTGGGATCAATCTTCTCGTCTCGTATATCGTTCGACAACCGATTCCACATCGACTGTGTGCGAGTGAGAGAGAGAGAGAAGCGGGGATCGGTGTGCGGAGAAGATTAAGGAGATGGCAAGGA...

CDS

Download CDS FASTA

648 bp · TkA01G546050|TK1151|CDS

ATGGCAAGGAGACCGGACGAGGAGTACGATTACTTGTTCAAAGTAGTGTTGATAGGCGATTCAGGTGTTGGAAAATCCAATCTTCTCTCTCGATTCACCAGAAATGAATTCTGTTTGGAGTCTAAATCCACCATCGGCGTCGAATTCGCTACTCGTACCCTACAAGTTGAGGGAAGAACGATAAAGGCTCAGATTTGGGACACAGCAGGGCAAGAGCGATACAGAGCAATAACAAGTGCCTACTACAGAGGCGCCCTAGG...

Protein

Download Protein FASTA

215 aa · TkA01G546050|TK1151|PROTEIN

MARRPDEEYDYLFKVVLIGDSGVGKSNLLSRFTRNEFCLESKSTIGVEFATRTLQVEGRTIKAQIWDTAGQERYRAITSAYYRGALGALLVYDVTKPTTFENISRWLKELRDHADANIVIMLIGNKTDLKHLRAVAVEDAQSFAEREGLSFIETSALEAVNVEKSFQTILGEIYRIISKKSISGGEAGPVSVKQGETLVVGAQDGNTKKACCSSS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G546050`
TK1151 ID	TkA01G546050
OH-1004 ID	LXL04_036389
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	76.700
Protein coverage (%)	TK1151 99.070 / OH-1004 95.982 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G546050

Location Chr01:137100291-137101985 (-)

Description Similar to RAB11C: Ras-related protein Rab11C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09630`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At3g46830`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At1g07410`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036389 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009504 cell plate Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

KEGG gene cross-reference

ath:AT1G07410

ath:AT3G46830

bvg:104900042

nta:107829726

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.488

Rank 1 · TkA01G546050 · TK1151

Golgi apparatus0.479

Rank 2 · TkA01G546050 · TK1151

Cell membrane0.201

Rank 3 · TkA01G546050 · TK1151

Lysosome / Vacuole0.149

Rank 4 · TkA01G546050 · TK1151

Endoplasmic reticulum0.141

Rank 5 · TkA01G546050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00025Arf13-132 aa

PF00071Ras14-174 aa

PF08477Roc14-128 aa

PF01926MMR_HSR114-120 aa

PF00009GTP_EFTU14-33 aa

PF05783DLIC14-145 aa

PF10662PduV-EutP14-66 aa

PF04670Gtr1_RagA14-129 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G546050	`PF00025`	Arf	13	132	1.7e-12	47.9
TkA01G546050	`PF00071`	Ras	14	174	1.6e-62	210.6
TkA01G546050	`PF08477`	Roc	14	128	1.2e-34	119.8
TkA01G546050	`PF01926`	MMR_HSR1	14	120	1.8e-06	28.8
TkA01G546050	`PF00009`	GTP_EFTU	14	33	0.00011	22.6
TkA01G546050	`PF05783`	DLIC	14	145	0.017	14.7
TkA01G546050	`PF10662`	PduV-EutP	14	66	0.048	14.2
TkA01G546050	`PF04670`	Gtr1_RagA	14	129	0.09	12.9
TkA01G546050	`PF02421`	FeoB_N	14	71	0.1	12.8
TkA01G546050	`PF13479`	AAA_24	14	35	0.2	12.0
TkA01G546050	`PF03193`	RsgA_GTPase	15	35	3.2e-05	24.5
TkA01G546050	`PF13401`	AAA_22	15	96	0.011	16.8
TkA01G546050	`PF00005`	ABC_tran	15	38	0.037	15.3
TkA01G546050	`PF13191`	AAA_16	15	34	0.047	14.9
TkA01G546050	`PF05621`	TniB	15	36	0.19	11.9
TkA01G546050	`PF13555`	AAA_29	15	29	0.19	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04486`	Arabidopsis thaliana	sp\|O04486\|RAA2A_ARATH Ras-related protein RABA2a	85.700%	Swiss-Prot	High
`Q96283`	Arabidopsis thaliana	sp\|Q96283\|RAA2C_ARATH Ras-related protein RABA2c	75.100%	Swiss-Prot	High
`Q9LNW1`	Arabidopsis thaliana	sp\|Q9LNW1\|RAA2B_ARATH Ras-related protein RABA2b	73.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card