TkA01G534320 | RubberDandelionOmics

Gene overview

TkA01G534320

Reference: TK1151 Chr: Chr01 Coordinates: 134096342-134106503 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1958 bp · TkA01G534320|TK1151|cDNA

AAATCATATAAACTTCTCATAAAAGGGGAAAATTGTAAAAAGAGATTCTGGAACGGTGTGGCCGTACAAAGTTGCCGTTACAATTTACATGTACCCTTCGTACTCCGGAAGCATCACAACTTTCGACTCTTGATGATCAAACGCCCTTGCTCTAGGGTTTTCTCACGATGGGCACGACTTCTTCCAGCAAGAAAACCGCAGTATTTGAATTTCACTTTGACGATTTAGATGAACTTGCCGAGAAGAACTCCAGATGGAAC...

CDS

Download CDS FASTA

1368 bp · TkA01G534320|TK1151|CDS

ATGATACCATTGTTGACTTTTATATCGAGATACTTGAAGAAGATCAATCCTGCTGATGAAAGGGTCCACTTCTTCAACAGCTTTTTCTTTAGAAAGCTTGCAGATTTTGATGAAAATCAGTTGCAAAAGTTTGATGCAAAGGCAGCTTTTCAAAGAGTTCGTAAGTGGACAAAGAAAGTGAATATTTTTCAAAAGGATTACATTTTTATCCCTGTAAACTTCAGGCTGCATTGGAGTTTAATTGTTATCTGTCATCCTGG...

Protein

Download Protein FASTA

455 aa · TkA01G534320|TK1151|PROTEIN

MIPLLTFISRYLKKINPADERVHFFNSFFFRKLADFDENQLQKFDAKAAFQRVRKWTKKVNIFQKDYIFIPVNFRLHWSLIVICHPGEVTNFEDDDLEVALKVPCILHMDSIKGSHRGVENCIKCYLWEEWKERSHDTTEDISTIFNNLRFLRLEVPQQQNSYDCGLFMLHFMELFMKQAPSSFSPLSNFISKDWFYPTEASLKRVRIKRLIVELAKSKSQHVLSPNCNDKSSSEANEEEVEILDETCCNSKENSSDNTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G534320`
TK1151 ID	TkA01G534320
OH-1004 ID	LXL04_001448
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.400
Protein coverage (%)	TK1151 98.242 / OH-1004 46.298 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G534320

Location Chr01:134096342-134106503 (-)

Description Similar to ULP2B: Probable ubiquitin-like-specific protease 2B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09730`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	No verified direct reference in this release
`At4g33620`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	No verified direct reference in this release
`At1g10570`	Protease that catalyzes two essential functions in the SUMO pathway: processing of full-length SUMOs to their mature forms and deconjugation of SUMO from targeted proteins.	SUMO-conjugating and SUMO-deconjugating enzymes from Arabidopsis.2006 · DOI: 10.1104/pp.106.085415 Small ubiquitin-like modifier proteases OVERLY TOLERANT TO SALT1 and -2 regulate salt stress responses in Arabidopsis.2008 · DOI: 10.1105/tpc.108.058669

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001448 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0016925 protein sumoylation Biological Process

GO:0016926 protein desumoylation Biological Process

GO:0048576 positive regulation of short-day photoperiodism, flowering Biological Process

GO:0048578 positive regulation of long-day photoperiodism, flowering Biological Process

GO:0055046 microgametogenesis Biological Process

GO:2000765 regulation of cytoplasmic translation Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G09730

ath:AT1G10570

ath:AT1G60220

ath:AT4G33620

spo:2542268

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.886

Rank 1 · TkA01G534320 · TK1151

Cytoplasm0.222

Rank 2 · TkA01G534320 · TK1151

Mitochondrion0.042

Rank 3 · TkA01G534320 · TK1151

Cell membrane0.027

Rank 4 · TkA01G534320 · TK1151

Golgi apparatus0.014

Rank 5 · TkA01G534320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02902Peptidase_C488-189 aa

PF03290Peptidase_C5750-84 aa

PF22179RickCE_cat146-171 aa

PF03290Peptidase_C57149-188 aa

PF11373DUF3175414-442 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G534320	`PF02902`	Peptidase_C48	8	189	1.9e-33	116.9
TkA01G534320	`PF03290`	Peptidase_C57	50	84	0.12	11.8
TkA01G534320	`PF22179`	RickCE_cat	146	171	0.17	12.9
TkA01G534320	`PF03290`	Peptidase_C57	149	188	0.12	11.8
TkA01G534320	`PF11373`	DUF3175	414	442	0.036	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7S0`	Arabidopsis thaliana	sp\|Q8L7S0\|ULP2B_ARATH Probable ubiquitin-like-specific protease 2B	55.500%	Swiss-Prot	Medium
`Q0WKV8`	Arabidopsis thaliana	sp\|Q0WKV8\|ULP2A_ARATH Probable ubiquitin-like-specific protease 2A	40.300%	Swiss-Prot	Medium
`Q8RWN0`	Arabidopsis thaliana	sp\|Q8RWN0\|ULP1C_ARATH Ubiquitin-like-specific protease 1C	35.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card