TkA01G531400 | RubberDandelionOmics

Gene overview

TkA01G531400

Reference: TK1151 Chr: Chr01 Coordinates: 133373589-133376652 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1486 bp · TkA01G531400|TK1151|cDNA

CGCCGTTCAAATACTACTCCATCTTCATGTTCACACCATTTCCTGGTAACACATAGAATTCGATAATAGGCAAATAGTGCTTGTCTGACCGCCTCTCATATCTCACCGTAAATTGACATCGCTCCCTCTTTTGGCATAAACACCGGCAGCCGATCACTCCGTCGCGTCTCCGTGCAGACTTGTGTTGTACTCTTCTAAACCAAAAATTGAGATAGATAATAAGCAAAACAAAATGAAGCTGCGACTCAGATCCTATAAAA...

CDS

Download CDS FASTA

1065 bp · TkA01G531400|TK1151|CDS

ATGAAGCTGCGACTCAGATCCTATAAAACGAAAGAAACCCTGAAACTTGAAGTCCCAAATCCTTGCACTCTCCAACATCTCAAACAAATCCTCTCTGAAAACCTCCCTTCTTCCTCACAATCATCCACCGTTTATCTCTCTCTAAACCAAAAAGACAACCTCACAACCCCCTCCCCTCAAGATTCCATCCAATCAACCGGAATCACATCCGGTGACCTCATCTACTTCACCACTAACCCTAACGGATTCTCCCCCACCCC...

Protein

Download Protein FASTA

354 aa · TkA01G531400|TK1151|PROTEIN

MKLRLRSYKTKETLKLEVPNPCTLQHLKQILSENLPSSSQSSTVYLSLNQKDNLTTPSPQDSIQSTGITSGDLIYFTTNPNGFSPTPQQPQTPPDPTPQETEQPMEIDQVKNPGKSFSVPGFLRKVFTEEIGDNNGLNHKLLAIAVRAVLLESGFVEIDPISKTIQTTNNFNTQPNLHLASFHFTLPALLTPGPTETVKIKFQTLGTFCNVYGYITNGPVHSVQLNESKLVPFLNVVWANCGQSFETITENNRVSTIEPE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G531400`
TK1151 ID	TkA01G531400
OH-1004 ID	LXL04_001493
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	68.500
Protein coverage (%)	TK1151 15.254 / OH-1004 19.014 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G531400

Location Chr01:133373589-133376652 (+)

Description Similar to SKIP22: F-box protein SKIP22

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g23780`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g23770`	Putative F-box protein At1g23770.	No verified direct reference in this release
`At1g70360`	F-box protein At1g70360.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001493 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G23780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.805

Rank 1 · TkA01G531400 · TK1151

Cytoplasm0.316

Rank 2 · TkA01G531400 · TK1151

Mitochondrion0.033

Rank 3 · TkA01G531400 · TK1151

Cell membrane0.024

Rank 4 · TkA01G531400 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA01G531400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21403OTU1_UBXL1-38 aa

PF11543UN_NPL413-76 aa

PF00646F-box295-335 aa

PF12937F-box-like296-338 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G531400	`PF21403`	OTU1_UBXL	1	38	0.17	13.2
TkA01G531400	`PF11543`	UN_NPL4	13	76	0.002	19.4
TkA01G531400	`PF00646`	F-box	295	335	3.1e-07	30.7
TkA01G531400	`PF12937`	F-box-like	296	338	1.4e-09	38.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUB8`	Arabidopsis thaliana	sp\|Q9ZUB8\|SKI22_ARATH F-box protein SKIP22	35.400%	Swiss-Prot	Medium
`Q9ZUB9`	Arabidopsis thaliana	sp\|Q9ZUB9\|FB17_ARATH Putative F-box protein At1g23770	36.600%	Swiss-Prot	Medium
`O64600`	Arabidopsis thaliana	sp\|O64600\|FB81_ARATH F-box protein At1g70360	34.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card