RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G521990
Reference: TK1151 Chr: Chr01 Coordinates: 130943498-130944744 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1122 bp · TkA01G521990|TK1151|cDNA

ATGCCTCGGAGCTTACAGCCGTTGGACGTGGGAATTCAGGTTCCGTATCATTTCAGATGTCCGATTTCTCTTGACCTCATGAGGGATCCGGTCATCGTTGGAACCGGTCAGACATACGATCGTTCAAGCATCGAGTCATGGGCGTGGTGTGTGGCCAATCGGTCCTATGGTGTGGAACGGATTCCTACGCCCAAGCAACCTGCCGATCCGGTGATGGTTCAGTCATTGCTTAAACAAGCGTCGTCGGTGTCTAACACACG...

CDS

Download CDS FASTA

1122 bp · TkA01G521990|TK1151|CDS

ATGCCTCGGAGCTTACAGCCGTTGGACGTGGGAATTCAGGTTCCGTATCATTTCAGATGTCCGATTTCTCTTGACCTCATGAGGGATCCGGTCATCGTTGGAACCGGTCAGACATACGATCGTTCAAGCATCGAGTCATGGGCGTGGTGTGTGGCCAATCGGTCCTATGGTGTGGAACGGATTCCTACGCCCAAGCAACCTGCCGATCCGGTGATGGTTCAGTCATTGCTTAAACAAGCGTCGTCGGTGTCTAACACACG...

Protein

Download Protein FASTA

373 aa · TkA01G521990|TK1151|PROTEIN

MPRSLQPLDVGIQVPYHFRCPISLDLMRDPVIVGTGQTYDRSSIESWAWCVANRSYGVERIPTPKQPADPVMVQSLLKQASSVSNTRHARLSALRRLRGLARDSDKNRLVLATQKACEILLEVLFSETNRNSSDLTHESLANLAMHALSETECLLVSSDPDRISYLISLLSHSSIDVRINTAALLENVVAGTRSPDLRAEISSRDEIFDGIVGILDYPMSYPRALKVGIKALFAFCMVKQHRHKAVEAGAVEALIDRLPD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G521990
TK1151 IDTkA01G521990
OH-1004 IDLXL04_001615
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)88.400
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G521990
LocationChr01:130943498-130944744 (+)
DescriptionSimilar to PUB26: U-box domain-containing protein 26
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g49780 Functions as an E3 ubiquitin ligase. No verified direct reference in this release
At3g19380 Functions as an E3 ubiquitin ligase. No verified direct reference in this release
At2g35930 E3 ubiquitin-protein ligase that negatively regulates water stress response.
Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress.2008 · DOI: 10.1105/tpc.108.060699
Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085
At3g52450 E3 ubiquitin-protein ligase that negatively regulates water stress response.
Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress.2008 · DOI: 10.1105/tpc.108.060699
Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085
The ubiquitin ligase PUB22 targets a subunit of the exocyst complex required for PAMP-triggered responses in Arabidopsis.2012 · DOI: 10.1105/tpc.112.104463
At5g37490 Functions as an E3 ubiquitin ligase. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001615 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0002679 respiratory burst involved in defense response Biological Process
GO:0006952 defense response Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0051865 protein autoubiquitination Biological Process
GO:0098542 defense response to other organism Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0004842 ubiquitin-protein transferase activity Molecular Function
GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference
ath:AT1G49780
ath:AT2G35930
ath:AT3G19380
ath:AT3G52450
ath:AT5G37490
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.524
Rank 1 · TkA01G521990 · TK1151
Cytoplasm0.444
Rank 2 · TkA01G521990 · TK1151
Cell membrane0.120
Rank 3 · TkA01G521990 · TK1151
Endoplasmic reticulum0.060
Rank 4 · TkA01G521990 · TK1151
Lysosome / Vacuole0.030
Rank 5 · TkA01G521990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04564U-box14-72 aa
PF15592Imm4120-47 aa
PF13445zf-RING_UBOX20-47 aa
PF23295Arm_471-134 aa
PF25598ARM_PUB73-323 aa
PF24768ARM_ARMC577-188 aa
PF25571TPR_CCP1_N83-135 aa
PF13513HEAT_EZ93-105 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G521990PF04564U-box14722.1e-1041.3
TkA01G521990PF15592Imm4120470.1313.0
TkA01G521990PF13445zf-RING_UBOX20470.1612.7
TkA01G521990PF23295Arm_4711340.09412.7
TkA01G521990PF25598ARM_PUB733233.3e-68231.1
TkA01G521990PF24768ARM_ARMC5771884.4e-0833.6
TkA01G521990PF25571TPR_CCP1_N831350.03114.1
TkA01G521990PF13513HEAT_EZ931050.01716.4
TkA01G521990PF00514Arm1041270.001918.9
TkA01G521990PF13513HEAT_EZ1451870.01716.4
TkA01G521990PF02985HEAT1641890.1613.1
TkA01G521990PF00514Arm1661880.001918.9
TkA01G521990PF24768ARM_ARMC52073224.4e-0833.6
TkA01G521990PF15592Imm412162470.1313.0
TkA01G521990PF25571TPR_CCP1_N2242720.03114.1
TkA01G521990PF13513HEAT_EZ2412540.01716.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FXA4Arabidopsis thalianasp|Q9FXA4|PUB26_ARATH U-box domain-containing protein 2654.900%Swiss-ProtHigh
Q9LT79Arabidopsis thalianasp|Q9LT79|PUB25_ARATH U-box domain-containing protein 2555.100%Swiss-ProtHigh
Q84TG3Arabidopsis thalianasp|Q84TG3|PUB23_ARATH E3 ubiquitin-protein ligase PUB2329.200%Swiss-ProtLow
Q9SVC6Arabidopsis thalianasp|Q9SVC6|PUB22_ARATH E3 ubiquitin-protein ligase PUB2227.100%Swiss-ProtLow
Q5PNY6Arabidopsis thalianasp|Q5PNY6|PUB21_ARATH U-box domain-containing protein 2126.400%Swiss-ProtLow

JBrowse

View in Genome Browser