TkA01G512580 | RubberDandelionOmics

Gene overview

TkA01G512580

Reference: TK1151 Chr: Chr01 Coordinates: 128468481-128469803 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1323 bp · TkA01G512580|TK1151|cDNA

ATGGCTTCTTCTTCTTCTTCTTCTTCTTCACTATCACTCCTTTTGCTTTTCTTTCTGTTAATTGTCTCTTCATCGGTGGCCAAAACCTCATCACGTCCAAAGGCTCTTCTTCTTCAAGTAACCAAAGATGCCAAAACACTTCAATACGTCACTCAAATTTCCCAAAGAACGCCTCTCGTCCCCGTCAAGTTAACCGTCGATCTCGGCGGCGACTACATGTGGGTCAACTGTGAGCGAACCTACACCTCCTCCACCTACCG...

CDS

Download CDS FASTA

1323 bp · TkA01G512580|TK1151|CDS

ATGGCTTCTTCTTCTTCTTCTTCTTCTTCACTATCACTCCTTTTGCTTTTCTTTCTGTTAATTGTCTCTTCATCGGTGGCCAAAACCTCATCACGTCCAAAGGCTCTTCTTCTTCAAGTAACCAAAGATGCCAAAACACTTCAATACGTCACTCAAATTTCCCAAAGAACGCCTCTCGTCCCCGTCAAGTTAACCGTCGATCTCGGCGGCGACTACATGTGGGTCAACTGTGAGCGAACCTACACCTCCTCCACCTACCG...

Protein

Download Protein FASTA

440 aa · TkA01G512580|TK1151|PROTEIN

MASSSSSSSSLSLLLLFFLLIVSSSVAKTSSRPKALLLQVTKDAKTLQYVTQISQRTPLVPVKLTVDLGGDYMWVNCERTYTSSTYRPAPCGSAACQLLNTTSCTTECYSAPAPDCYNNTCGHGPTNSVANTGTSGQLGADVITIQSTNGKNVLKVVTVPRLYFVCGTNFIEAGLAAGVTGMAGLGRTGASIPSQLSSYFKFDRKFALCLSSSTKSSGVVFFGNGPYTLLPNIDASSSLTYTPLIINPVTENGFLGDASP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G512580`
TK1151 ID	TkA01G512580
OH-1004 ID	LXL04_001774
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 94.318 / OH-1004 94.533 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G512580`
Location	Chr01:128468481-128469803 (+)
Description	Similar to GIP2: Probable aspartic proteinase GIP2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001774` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0006952 defense response Biological Process GO:0005576 extracellular region Cellular Component GO:0048046 apoplast Cellular Component GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0019863 IgE binding Molecular Function GO:0042802 identical protein binding Molecular Function GO:0045735 nutrient reservoir activity Molecular Function
KEGG gene cross-reference	gmx:100800584 lang:109345795 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.376

Rank 1 · TkA01G512580 · TK1151

Extracellular0.315

Rank 2 · TkA01G512580 · TK1151

Endoplasmic reticulum0.133

Rank 3 · TkA01G512580 · TK1151

Cytoplasm0.087

Rank 4 · TkA01G512580 · TK1151

Lysosome / Vacuole0.048

Rank 5 · TkA01G512580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14543TAXi_N49-224 aa

PF14541TAXi_C261-422 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G512580	`PF14543`	TAXi_N	49	224	5.8e-46	157.6
TkA01G512580	`PF14541`	TAXi_C	261	422	1.7e-56	191.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card