Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1826 bp · TkA01G508450|TK1151|cDNA
ATATAACGCACCTCACTTAAATGCTCTCTTTAAAGTAAATATTTTTCTATTATTTCATGAAACACATCCACCGTTTCTCTTTGTAAAAGAAAACAAAAAGAGAAGGTGAGGAAAAGCCAAACACAAAGCCACCTGTTTCTCTCGTAGAAACCCACCACAATCTTGTGATCAAATTGCTCAAAAACCCTCTCTTTTTTAGCAATTCAATCTTCATTTCTTTCCCTTTTGATTTGGGTTTTTTGTAAATGGGTCTATCTTTA...
1050 bp · TkA01G508450|TK1151|CDS
ATGGCTGCTGGTCCTGAAATTTCTGTTGAATCAACAGCAGTGTCTGCTTCTCCTCCTGCTGTTGATCAATCTCCACCTAAAATCGAGCCTTCTATCGTTAAAAGAGTCGATAGTGAGAGTGATAATTTCGTCAATTCCGATGATGAGAATGGTTCAATTATCACCCATGGCGAGTCCAAAAAAGGGTCTGATTCTGATTCGAAATCAGAAATGAAAATGCAAGATTTTGTTGATATGTTGTCCAATTTGAAGTTGAATCC...
Protein
Download Protein FASTA349 aa · TkA01G508450|TK1151|PROTEIN
MAAGPEISVESTAVSASPPAVDQSPPKIEPSIVKRVDSESDNFVNSDDENGSIITHGESKKGSDSDSKSEMKMQDFVDMLSNLKLNPMAKEFFPSSYSPIDRNRDQPELGLNYFVQPAYYKNYPENGIEGYPNNRRRRNNYSNTRRLSNGRSFRAQREDSIKRTVYVSDIDHNVTEEQLAGLFSGYGHVLDCRVCGDPHSRLRFAFVEFGDENSARAALNLCGTMLGFSQITVLPSKTAILPVNPTFLPRSEDEREMCAR...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G508450 |
|---|---|
| TK1151 ID | TkA01G508450 |
| OH-1004 ID | LXL04_001809 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G508450 | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:127356117-127359797 (-) | ||||||||||||||||||
| Description | Similar to CID9: Polyadenylate-binding protein-interacting protein 9 | ||||||||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||||||||
| GO annotations (OH1004 source) | GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0000166 nucleotide binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003729 mRNA binding Molecular Function | ||||||||||||||||||
| KEGG gene cross-reference | ath:AT1G32790 ath:AT1G53650 ath:AT3G14450 ath:AT3G49390 ath:AT4G10610 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07145PAM284-96 aaPF24572RBD_RDR6162-194 aaPF16842RRM_occluded163-226 aaPF14703PHM7_cyt163-187 aaPF23085RRM_PARP14_3163-214 aaPF00076RRM_1165-227 aaPF14703PHM7_cyt201-225 aaPF24572RBD_RDR6204-222 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G508450 | PF07145 | PAM2 | 84 | 96 | 7.7e-05 | 22.8 |
| TkA01G508450 | PF24572 | RBD_RDR6 | 162 | 194 | 0.042 | 14.7 |
| TkA01G508450 | PF16842 | RRM_occluded | 163 | 226 | 0.0044 | 17.6 |
| TkA01G508450 | PF14703 | PHM7_cyt | 163 | 187 | 0.025 | 15.5 |
| TkA01G508450 | PF23085 | RRM_PARP14_3 | 163 | 214 | 0.14 | 13.0 |
| TkA01G508450 | PF00076 | RRM_1 | 165 | 227 | 4.1e-23 | 81.7 |
| TkA01G508450 | PF14703 | PHM7_cyt | 201 | 225 | 0.025 | 15.5 |
| TkA01G508450 | PF24572 | RBD_RDR6 | 204 | 222 | 0.042 | 14.7 |
| TkA01G508450 | PF16842 | RRM_occluded | 260 | 309 | 0.0044 | 17.6 |
| TkA01G508450 | PF24572 | RBD_RDR6 | 260 | 292 | 0.042 | 14.7 |
| TkA01G508450 | PF23085 | RRM_PARP14_3 | 260 | 296 | 0.14 | 13.0 |
| TkA01G508450 | PF00076 | RRM_1 | 262 | 329 | 4.1e-23 | 81.7 |
| TkA01G508450 | PF14703 | PHM7_cyt | 276 | 308 | 0.025 | 15.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q9LRR6 | Arabidopsis thaliana | sp|Q9LRR6|CID9_ARATH Polyadenylate-binding protein-interacting protein 9 | 58.200% | Swiss-Prot | High |
Q9C8M0 | Arabidopsis thaliana | sp|Q9C8M0|CID8_ARATH Polyadenylate-binding protein-interacting protein 8 | 64.100% | Swiss-Prot | High |
Q9S7N9 | Arabidopsis thaliana | sp|Q9S7N9|CID12_ARATH Polyadenylate-binding protein-interacting protein 12 | 62.000% | Swiss-Prot | High |
Q9LPI5 | Arabidopsis thaliana | sp|Q9LPI5|CID11_ARATH Polyadenylate-binding protein-interacting protein 11 | 61.300% | Swiss-Prot | High |
Q9SG10 | Arabidopsis thaliana | sp|Q9SG10|CID10_ARATH Polyadenylate-binding protein-interacting protein 10 | 59.000% | Swiss-Prot | High |