TkA01G505340 | RubberDandelionOmics

Gene overview

TkA01G505340

Reference: TK1151 Chr: Chr01 Coordinates: 126528291-126531376 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1807 bp · TkA01G505340|TK1151|cDNA

ATCTGAAGTACGTTGTTACCAATGCGTTTTAAAGAGTATAGTCTTCATTTCGGACCGGCGAACACTTGTTTTTGAGGGGTAAAATAATTGAGGGACAAGTTGTATTAATCAAAGAAGTTTAGGGGAAGCTGATGTAACTTATCCAACTACCAACCAAACACATCAGATTCTTCCCTAGACTCCACCACATACAAACACTTCCCTTCTCCTTTGTTCCTTCGATCCATCGCTTTTCTCTTTTTTCCTAAACTAGTTTGCTC...

CDS

Download CDS FASTA

1122 bp · TkA01G505340|TK1151|CDS

ATGGACAACACACCCAACAATCTACAGTTGGCAGTTATCCCCGAAACTAAAGACCATTCATCACCATCTAATCAAGAAAGGGACTCAGAGTCTATGCATCAAAGCCCTAGTCCTGATAGCGGGACCCATGCCTCAAATTCCAATCAAGAACCACCCGTAACACCCAAAAAAGCCTCACAACAAACACCTCCACCTGTTGGCTCTATATCAGAAGCTGATAGAGAAAATTATATTGTCGCATTAAGGCCTGAAAAGGGGCT...

Protein

Download Protein FASTA

373 aa · TkA01G505340|TK1151|PROTEIN

MDNTPNNLQLAVIPETKDHSSPSNQERDSESMHQSPSPDSGTHASNSNQEPPVTPKKASQQTPPPVGSISEADRENYIVALRPEKGLDKLPLRRNTDNVTPTDPGITFSKLPEKPTGDGYNWRKYGQKLVKGNTFVRSYYKCTFGNCPARKQVEHSHDGHITEINYLWKHEHPKPVNTLVKGSAFVMPIQSKGSDEVSLVTSEEQSSMHHDSEPSETGTNQLQLVLVPSESSEMRSEGNNGISSDSKRQKRETEGIPTKT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G505340`
TK1151 ID	TkA01G505340
OH-1004 ID	LXL04_001833
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G505340

Location Chr01:126528291-126531376 (+)

Description Similar to WRKY24: WRKY transcription factor WRKY24

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38470`	Transcription factor.	Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses.2009 · DOI: 10.1007/s11103-008-9408-3 Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance.2011 · DOI: 10.1007/s00425-011-1375-2 Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis.2011 · DOI: 10.1105/tpc.111.084996 Arabidopsis sigma factor binding proteins are activators of the WRKY33 transcription factor in plant defense.2011 · DOI: 10.1105/tpc.111.090571 Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection.2012 · DOI: 10.1104/pp.111.192641
`At1g13960`	Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.	Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68 Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q6B6R4`	Transcription repressor (By similarity).	No verified direct reference in this release
`Os01g0826400`	May participate in transcriptional regulation of abscisic acid and gibberellin signaling.	Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312 A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001833 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009627 systemic acquired resistance Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009739 response to gibberellin Biological Process

KEGG gene cross-reference

ath:AT2G38470

ath:AT4G26640

dosa:Os01g0826400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.939

Rank 1 · TkA01G505340 · TK1151

Cytoplasm0.173

Rank 2 · TkA01G505340 · TK1151

Cell membrane0.021

Rank 3 · TkA01G505340 · TK1151

Mitochondrion0.020

Rank 4 · TkA01G505340 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA01G505340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106WRKY118-173 aa

PF23549Zn_ribbon_GRF_2137-147 aa

PF03101FAR1142-173 aa

PF03101FAR1241-271 aa

PF03106WRKY278-335 aa

PF03101FAR1284-336 aa

PF23549Zn_ribbon_GRF_2292-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G505340	`PF03106`	WRKY	118	173	8.8e-49	164.3
TkA01G505340	`PF23549`	Zn_ribbon_GRF_2	137	147	0.97	10.0
TkA01G505340	`PF03101`	FAR1	142	173	4.9	8.7
TkA01G505340	`PF03101`	FAR1	241	271	4.9	8.7
TkA01G505340	`PF03106`	WRKY	278	335	8.8e-49	164.3
TkA01G505340	`PF03101`	FAR1	284	336	4.9	8.7
TkA01G505340	`PF23549`	Zn_ribbon_GRF_2	292	306	0.97	10.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8P5`	Arabidopsis thaliana	sp\|Q8S8P5\|WRK33_ARATH Probable WRKY transcription factor 33	46.100%	Swiss-Prot	Medium
`Q9XI90`	Arabidopsis thaliana	sp\|Q9XI90\|WRKY4_ARATH Probable WRKY transcription factor 4	42.300%	Swiss-Prot	Medium
`Q6B6R4`	Oryza sativa subsp. indica	sp\|Q6B6R4\|WRK24_ORYSI WRKY transcription factor WRKY24	46.500%	Swiss-Prot	Medium
`Q6IEQ7`	Oryza sativa subsp. japonica	sp\|Q6IEQ7\|WRK24_ORYSJ WRKY transcription factor WRKY24	47.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card