TkA01G503560 | RubberDandelionOmics

Gene overview

TkA01G503560

Reference: TK1151 Chr: Chr01 Coordinates: 126092192-126094745 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2138 bp · TkA01G503560|TK1151|cDNA

CACGCGCTCACCGTCCCTCACAGTCACAGTAGCCCCGCCATAAACCCCACAACTTTCTCGATACCTTCGCTTTTCTCCATTCTCGTGTCCCTCCCCCCATTTCATCTCCCTTCCATTCCACGCCAATTCCTCCCTCTTCTTTAACCCCAAATCCCTAACCAAAATTCACCACATTTCACCATGCCTGCCGCCGCTGCACCACCGTCACCCGCCGAAACCCTCGACGAAACCACCAACCTACTATGTCAGCTTCTGCCGGC...

CDS

Download CDS FASTA

1035 bp · TkA01G503560|TK1151|CDS

ATGCCTGCCGCCGCTGCACCACCGTCACCCGCCGAAACCCTCGACGAAACCACCAACCTACTATGTCAGCTTCTGCCGGCTTCTCTGTCCATCAACTGTTTTCCCGGCCGCTGGCAGGTATTGAGGTCTAAACTTGCCACTCTCAAGTCCCTTCTCTCTGAACTCTCATATTCCACTCACTGGTCCGAGAATCAACTCCTCCTCACGCTGCTACCCAACCTCCTATCCACCCTCCGCCGCATCCAGACCTTATGCGACCG...

Protein

Download Protein FASTA

344 aa · TkA01G503560|TK1151|PROTEIN

MPAAAAPPSPAETLDETTNLLCQLLPASLSINCFPGRWQVLRSKLATLKSLLSELSYSTHWSENQLLLTLLPNLLSTLRRIQTLCDRCTDSTYTAGKLLMQSDLDMAAGWLSKQLHDLDLLLRSGVLRQSNAIVLSQPAPGSAKEDLSLFVRDLFTRLQIGGVEFKRKALESLIQLLVEDEKAATLVAKEGNIGYLINLFDVHTHREQSVSAISILACASDQSRKTVFEEGGLGPLLRIVESGSLQLKEKASMAVEAITA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G503560`
TK1151 ID	TkA01G503560
OH-1004 ID	LXL04_001855
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 78.779 / OH-1004 48.393 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G503560`
Location	Chr01:126092192-126094745 (-)
Description	Similar to PUB4: U-box domain-containing protein 4
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001855` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000011 vacuole inheritance Biological Process GO:0000045 autophagosome assembly Biological Process GO:0016567 protein ubiquitination Biological Process GO:0034614 cellular response to reactive oxygen species Biological Process GO:0048364 root development Biological Process GO:0048658 anther wall tapetum development Biological Process GO:0071562 nucleus-vacuole junction assembly Biological Process GO:1904821 chloroplast disassembly Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0043495 protein-membrane adaptor activity Molecular Function GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference	ago:AGOS_AEL048W ath:AT2G23140 kla:KLLA0_A11286g These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.520

Rank 1 · TkA01G503560 · TK1151

Nucleus0.407

Rank 2 · TkA01G503560 · TK1151

Cell membrane0.195

Rank 3 · TkA01G503560 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA01G503560 · TK1151

Lysosome / Vacuole0.041

Rank 5 · TkA01G503560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23005DUF703217-126 aa

PF13513HEAT_EZ69-76 aa

PF13513HEAT_EZ134-159 aa

PF25598ARM_PUB166-333 aa

PF00514Arm169-178 aa

PF13513HEAT_EZ169-182 aa

PF24768ARM_ARMC5177-330 aa

PF00514Arm206-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G503560	`PF23005`	DUF7032	17	126	4.8e-34	117.3
TkA01G503560	`PF13513`	HEAT_EZ	69	76	8.5	7.8
TkA01G503560	`PF13513`	HEAT_EZ	134	159	8.5	7.8
TkA01G503560	`PF25598`	ARM_PUB	166	333	0.00021	21.5
TkA01G503560	`PF00514`	Arm	169	178	3.8e-09	37.0
TkA01G503560	`PF13513`	HEAT_EZ	169	182	8.5	7.8
TkA01G503560	`PF24768`	ARM_ARMC5	177	330	3.2e-08	34.0
TkA01G503560	`PF00514`	Arm	206	210	3.8e-09	37.0
TkA01G503560	`PF13513`	HEAT_EZ	206	256	8.5	7.8
TkA01G503560	`PF00514`	Arm	220	251	3.8e-09	37.0
TkA01G503560	`PF00514`	Arm	261	301	3.8e-09	37.0
TkA01G503560	`PF13513`	HEAT_EZ	290	334	8.5	7.8
TkA01G503560	`PF00514`	Arm	314	334	3.8e-09	37.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card