TkA01G499830 | RubberDandelionOmics

Gene overview

TkA01G499830

Reference: TK1151 Chr: Chr01 Coordinates: 125231803-125234382 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

825 bp · TkA01G499830|TK1151|cDNA

GACTAATCAAGGTACAATAACAGACCTCACTCTCTTTTCTTCCTCATCAAGAAACCCTAACAGACATGCATCATATTCAGACTAAACTTCCTGGTGTCAAATCCATCATTTCCAAAGCCAGCAAAGCATCAGCAGATATCCTTGTTGAATCCGGTGATAAAATCCAATTTGGTGATCTTTACTTAGAGGTTCGTGCAACCCCAGGGCATACAGTAGGGTGTGTTACATATGTGTCAGGAGATGGGTCTGATCAGCCTCAA...

CDS

Download CDS FASTA

747 bp · TkA01G499830|TK1151|CDS

ATGCTACGGCTACGATGTTTATGGTTGTCTAGTTCTTCACTACATTTTAATCAGCAATTTCTCCCTTCTCCGATCCTATCTTCATCGTCATCAGCTTCATTTAGATCAAAGATGGAAGCTGTTTCGTATTCAACACGATCGTCTTCGTCATCAAAGAAGTTGCTGTTTCGTCAGTTGTTCGAGAAGGAATCATCTACTTACACATACCTTCTAGCCGATGCTTCTCATCCAGATAAGCCTGCTCTGCTGGTTGACCCTGT...

Protein

Download Protein FASTA

248 aa · TkA01G499830|TK1151|PROTEIN

MLRLRCLWLSSSSLHFNQQFLPSPILSSSSSASFRSKMEAVSYSTRSSSSSKKLLFRQLFEKESSTYTYLLADASHPDKPALLVDPVDKTVDRDLSLVKDLGLKLIYALNTHVHADHVTGSGLIKTKLPGVKSIISKASKASADILVESGDKIQFGDLYLEVRATPGHTVGCVTYVSGDGSDQPQPRLAFTGDAVLIRGCGRTDFQGGSSQQLYESVHSQIFTLPEDTFIYPAHDYKGFTHCGRRDAI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G499830`
TK1151 ID	TkA01G499830
OH-1004 ID	LXL04_001897
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.600
Protein coverage (%)	TK1151 96.774 / OH-1004 81.333 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G499830

Location Chr01:125231803-125234382 (-)

Description Similar to GLY3: Persulfide dioxygenase ETHE1 homolog, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g53580`	Sulfur dioxygenase that plays an essential role in hydrogen sulfide catabolism in the mitochondrial matrix.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001897 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006749 glutathione metabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009960 endosperm development Biological Process

GO:0048316 seed development Biological Process

GO:0070813 hydrogen sulfide metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005506 iron ion binding Molecular Function

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G53580

atu:Atu3465

bta:509150

hsa:23474

mmu:66071

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.717

Rank 1 · TkA01G499830 · TK1151

Plastid0.174

Rank 2 · TkA01G499830 · TK1151

Cytoplasm0.147

Rank 3 · TkA01G499830 · TK1151

Nucleus0.093

Rank 4 · TkA01G499830 · TK1151

Peroxisome0.037

Rank 5 · TkA01G499830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00753Lactamase_B66-234 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G499830	`PF00753`	Lactamase_B	66	234	1.2e-13	52.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8L4`	Arabidopsis thaliana	sp\|Q9C8L4\|ETHE1_ARATH Persulfide dioxygenase ETHE1 homolog, mitochondrial	82.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card