TkA01G495390 | RubberDandelionOmics

Gene overview

TkA01G495390

Reference: TK1151 Chr: Chr01 Coordinates: 123959486-123965482 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1209 bp · TkA01G495390|TK1151|cDNA

ATGCGGTCGCTGTTGCGATTTAACCAACACAAAATTTCAACAACGACTGGTTCTGTCGAAGGCTCGCGTTATTCTTCAAATAGGTTAAGTTCTGGTATTAGGAGTATCGTCACGACCTGTAGAGCGGTGCTTTTGCCACGGTTCGGCGGTCCTGATGTTCTTGAAGTGCGAGATGATGTCCGTGTTCCTGATCTCAAGCCGAATGAGGTACTCGTTCGAGTTCGCGCCGTTTCGGTTAATCCTCTCGACACTAGGATGCG...

CDS

Download CDS FASTA

1209 bp · TkA01G495390|TK1151|CDS

ATGCGGTCGCTGTTGCGATTTAACCAACACAAAATTTCAACAACGACTGGTTCTGTCGAAGGCTCGCGTTATTCTTCAAATAGGTTAAGTTCTGGTATTAGGAGTATCGTCACGACCTGTAGAGCGGTGCTTTTGCCACGGTTCGGCGGTCCTGATGTTCTTGAAGTGCGAGATGATGTCCGTGTTCCTGATCTCAAGCCGAATGAGGTACTCGTTCGAGTTCGCGCCGTTTCGGTTAATCCTCTCGACACTAGGATGCG...

Protein

Download Protein FASTA

402 aa · TkA01G495390|TK1151|PROTEIN

MRSLLRFNQHKISTTTGSVEGSRYSSNRLSSGIRSIVTTCRAVLLPRFGGPDVLEVRDDVRVPDLKPNEVLVRVRAVSVNPLDTRMRAGYGRSLFESLLPLILGRDVSGEIAAIGRSVQTLNVGQEVFGALHPTAVRGTYTDYAILAEDQLTPKPSTISHVDASAIPFAALTAWRALKSTARITKGQRVLVVGGGGAVGYSAVQLAVAAGCMVSATCENESIDRLLAAGAEQALDYTSEDLEVTLKGKYDAVLDTIGIQQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G495390`
TK1151 ID	TkA01G495390
OH-1004 ID	LXL04_025265
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	31.300
Protein coverage (%)	TK1151 83.582 / OH-1004 76.808 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G495390`
Location	Chr01:123959486-123965482 (-)
Description	Similar to EO: 2-methylene-furan-3-one reductase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025265` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009409 response to cold Biological Process GO:0005634 nucleus Cellular Component GO:0009507 chloroplast Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0009579 thylakoid Cellular Component GO:0009941 chloroplast envelope Cellular Component GO:0010319 stromule Cellular Component GO:0048046 apoplast Cellular Component GO:0008270 zinc ion binding Molecular Function GO:0035671 enone reductase activity Molecular Function GO:0035798 2-alkenal reductase (NADPH) activity Molecular Function GO:0102978 furaneol oxidoreductase activity Molecular Function
KEGG gene cross-reference	ath:AT1G23740 sly:101250690 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.904

Rank 1 · TkA01G495390 · TK1151

Cytoplasm0.081

Rank 2 · TkA01G495390 · TK1151

Nucleus0.045

Rank 3 · TkA01G495390 · TK1151

Plastid0.037

Rank 4 · TkA01G495390 · TK1151

Cell membrane0.028

Rank 5 · TkA01G495390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16884ADH_N_260-129 aa

PF08240ADH_N66-155 aa

PF08240ADH_N182-191 aa

PF01262AlaDh_PNT_C185-227 aa

PF13241NAD_binding_7185-242 aa

PF05368NmrA187-247 aa

PF00107ADH_zinc_N197-280 aa

PF13602ADH_zinc_N_2229-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G495390	`PF16884`	ADH_N_2	60	129	0.041	14.5
TkA01G495390	`PF08240`	ADH_N	66	155	6.5e-15	56.0
TkA01G495390	`PF08240`	ADH_N	182	191	6.5e-15	56.0
TkA01G495390	`PF01262`	AlaDh_PNT_C	185	227	0.06	13.5
TkA01G495390	`PF13241`	NAD_binding_7	185	242	0.2	12.9
TkA01G495390	`PF05368`	NmrA	187	247	0.25	11.6
TkA01G495390	`PF00107`	ADH_zinc_N	197	280	3.3e-11	44.0
TkA01G495390	`PF13602`	ADH_zinc_N_2	229	370	7.6e-16	60.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card