TkA01G489720 | RubberDandelionOmics

Gene overview

TkA01G489720

Reference: TK1151 Chr: Chr01 Coordinates: 122544017-122549962 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2358 bp · TkA01G489720|TK1151|cDNA

AGCCACTTTGATCAGATTACCCATTCGAACTCTCTCATATTCTCCATTCACTTTAGAATCCACTATTTCTTCAATCCAATTACTATTTCCACCATTTTCGTCACTAACCTTCTCACGCACCCACTTAACCATCGGTCTTTCATATCCACCGCTTTGATCACCGCCTTGTGGGCTTCTTCCGGTTATCATCTCCAGCATCACTACTCTGTAGCTGTAAACATCGACTTTTGAGGTAATCGGAAGACTGACAAAAAACCATT...

CDS

Download CDS FASTA

1599 bp · TkA01G489720|TK1151|CDS

ATGTCGCTAACGAGTGTGAAGATGTCGGAGGATGTGTGGCTAACATGTCTCACTCATGCATTGTCCACCGAGACTGAAGAAATTATGGGGCTTCTTCTCGGTGATATACAGCACTCCAAAAATGGAAGCGTGACTGCCCTAATTTGGGGAGCATTACCACAACCACGATGTGATAGACAGAAGGACCGTGTTGAGACAAATCCTGAGCAGTTGACAGCTGCATCAGTTCAGGCTGAGATATCCTTTATATATGTACGGAC...

Protein

Download Protein FASTA

532 aa · TkA01G489720|TK1151|PROTEIN

MSLTSVKMSEDVWLTCLTHALSTETEEIMGLLLGDIQHSKNGSVTALIWGALPQPRCDRQKDRVETNPEQLTAASVQAEISFIYVRTQAMYQLLDSGFIGLIFSCFNEDQYKVGRIQVTAFQSLDGKQNQVLKQNFSPINKSSIIDLESSISSTENSLTNSGPTQSLEYDTGDSKASAITLKGGAKPSALKGFFANADTLNTESGIVDIDPMDMSESMQEAMHRSNMEMSGAEYVRKEVPLHVLPTLSLVNLESPLTSFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G489720`
TK1151 ID	TkA01G489720
OH-1004 ID	LXL04_002026
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.900
Protein coverage (%)	TK1151 75.000 / OH-1004 99.754 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G489720`
Location	Chr01:122544017-122549962 (+)
Description	Similar to brcc3: Lys-63-specific deubiquitinase BRCC36
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002026` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006302 double-strand break repair Biological Process GO:0006508 proteolysis Biological Process GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process GO:0010212 response to ionizing radiation Biological Process GO:0045739 positive regulation of DNA repair Biological Process GO:0051301 cell division Biological Process GO:0070536 protein K63-linked deubiquitination Biological Process GO:0140861 DNA repair-dependent chromatin remodeling Biological Process GO:0000922 spindle pole Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0070552 BRISC complex Cellular Component
KEGG gene cross-reference	dre:100333845 sasa:100195855 xtr:549211 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.492

Rank 1 · TkA01G489720 · TK1151

Cytoplasm0.428

Rank 2 · TkA01G489720 · TK1151

Mitochondrion0.076

Rank 3 · TkA01G489720 · TK1151

Cell membrane0.076

Rank 4 · TkA01G489720 · TK1151

Endoplasmic reticulum0.059

Rank 5 · TkA01G489720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01398JAB3-56 aa

PF03665UPF01726-45 aa

PF03665UPF0172109-154 aa

PF18110BRCC36_C256-338 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G489720	`PF01398`	JAB	3	56	0.00018	22.0
TkA01G489720	`PF03665`	UPF0172	6	45	0.15	12.7
TkA01G489720	`PF03665`	UPF0172	109	154	0.15	12.7
TkA01G489720	`PF18110`	BRCC36_C	256	338	6.3e-22	78.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card