TkA01G482560 | RubberDandelionOmics

Gene overview

TkA01G482560

Reference: TK1151 Chr: Chr01 Coordinates: 120810810-120813968 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1460 bp · TkA01G482560|TK1151|cDNA

TTAATTATTTTAGTGGACATACCAAAGATAAAGGGAAACGGAAATAGCCAAAATACCAACGTAGCTTTATTTCTTCACAAATCATAACAAAAAACCTTGCCTCCCTCCCTCCATTCTCCTCCACTTCCTTTTGTACCTTCAGTCACTTTCCACCCATTTCCACAATTTCAAATTTCTTCAATTGAGATTCTCTCATTTTACAACATTTTAATTTACAGTGATGTCTGTGCCACTCGAACATGATTACATAGGGTTATCGG...

CDS

Download CDS FASTA

774 bp · TkA01G482560|TK1151|CDS

ATGTCTGTGCCACTCGAACATGATTACATAGGGTTATCGGAACCTTCTACGATGGAAAAAACCTCCAATCATTCATCTGAAAGTGACAAGAACAATCTTCTTAACCTCAAAGCCACTGAATTGCGACTTGGGTTACCTGGTTTAGGTCAATATCCGGATGAAAACTCACACTCATGTAAGAATAGCCCTAGGGAGAATTTCGTGTCTGGAGCTAAAAGAGGGTTTTCTGATTTTGATGGTGATTATGGGAAGGGTTCTTG...

Protein

Download Protein FASTA

257 aa · TkA01G482560|TK1151|PROTEIN

MSVPLEHDYIGLSEPSTMEKTSNHSSESDKNNLLNLKATELRLGLPGLGQYPDENSHSCKNSPRENFVSGAKRGFSDFDGDYGKGSCSTTSVLFGINGCNESKQSQPPIPLPVDEKKNASVTTENRTSKAQVVGWPPIRSFRKNTMASNLSKNDDVTEGNLGCAGCLYVKVSMDGAPYLRKVDLKTCKNYSQLTMALEKMFDTFTLVILTGSNFNRELRTCGGATAVVLRWSEKASVLRWSEKASVLRWSEKESVLR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G482560`
TK1151 ID	TkA01G482560
OH-1004 ID	LXL04_019003
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	45.000
Protein coverage (%)	TK1151 78.210 / OH-1004 71.331 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G482560

Location Chr01:120810810-120813968 (-)

Description Similar to IAA27: Auxin-responsive protein IAA27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g29080`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At2g22670`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At5g65670`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0230700`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`Os06g0335500`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`Os01g0231000`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019003 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010311 lateral root formation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:1901332 negative regulation of lateral root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT2G22670

ath:AT3G04730

ath:AT4G14550

ath:AT4G29080

ath:AT5G65670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.846

Rank 1 · TkA01G482560 · TK1151

Cytoplasm0.199

Rank 2 · TkA01G482560 · TK1151

Cell membrane0.070

Rank 3 · TkA01G482560 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkA01G482560 · TK1151

Plastid0.014

Rank 5 · TkA01G482560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02309AUX_IAA38-208 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G482560	`PF02309`	AUX_IAA	38	208	3.1e-42	145.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZSY8`	Arabidopsis thaliana	sp\|Q9ZSY8\|IAA27_ARATH Auxin-responsive protein IAA27	47.700%	Swiss-Prot	Medium
`Q38826`	Arabidopsis thaliana	sp\|Q38826\|IAA8_ARATH Auxin-responsive protein IAA8	43.000%	Swiss-Prot	Medium
`Q38827`	Arabidopsis thaliana	sp\|Q38827\|IAA9_ARATH Auxin-responsive protein IAA9	38.800%	Swiss-Prot	Medium
`Q75GB1`	Oryza sativa subsp. japonica	sp\|Q75GB1\|IAA17_ORYSJ Auxin-responsive protein IAA17	43.400%	Swiss-Prot	Medium
`Q5Z749`	Oryza sativa subsp. japonica	sp\|Q5Z749\|IAA21_ORYSJ Auxin-responsive protein IAA21	38.400%	Swiss-Prot	Medium
`Q5NB25`	Oryza sativa subsp. japonica	sp\|Q5NB25\|IAA3_ORYSJ Auxin-responsive protein IAA3	38.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card