TkA01G479660 | RubberDandelionOmics

Gene overview

TkA01G479660

Reference: TK1151 Chr: Chr01 Coordinates: 120159808-120162678 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2558 bp · TkA01G479660|TK1151|cDNA

TAAAACAACACACATCCACAAGTTTTCCATAACTGCAAATCCACTCAAAATTCATCATTGCTTTCCAGATTTCTTCCATATTTTTTATAACAATAAAATCTCCTATAAAGAATCAGTTAATTATATGACATGCTACGAATTCAACAATGGAGGGAAAGCCAAAATTCCTTCACGGGACACTCGAAGCCACCATCTTCCATGCCACACCTTATTCTCCACCCTTTCTACTTAATTGCATAAATCCAACAGGAAAACCCGCA...

CDS

Download CDS FASTA

2250 bp · TkA01G479660|TK1151|CDS

ATGGAGGGAAAGCCAAAATTCCTTCACGGGACACTCGAAGCCACCATCTTCCATGCCACACCTTATTCTCCACCCTTTCTACTTAATTGCATAAATCCAACAGGAAAACCCGCATATGTTACCATCAAGATTAATCACAAAAAAGTAGCATCAACTACTCACAAAAGTGAGAGAATTTGGAACCAAACGTTACGTGTTCTTTGTGCTTATCCAATAAACACAACAATAACAATCACCCTCAAAACAACATGCACCATTCT...

Protein

Download Protein FASTA

749 aa · TkA01G479660|TK1151|PROTEIN

MEGKPKFLHGTLEATIFHATPYSPPFLLNCINPTGKPAYVTIKINHKKVASTTHKSERIWNQTLRVLCAYPINTTITITLKTTCTILGKVNIQAHRLLQDSSLIDGMFPMLMENGKPNPELNLRFMLWFKPANLEPNWRQIIEKKEYNGLKDATFPLRGKCGVTLYQDSHHHPSFKPPCGLPRKLWEDVFVAIENAKYLIYIAGWSFNPNMILVRDSKTEIPHAKGVSLGELLKKKADEGVPVRIMIWDDETSLPFIKNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G479660`
TK1151 ID	TkA01G479660
OH-1004 ID	LXL04_002141
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G479660

Location Chr01:120159808-120162678 (-)

Description Similar to PLDALPHA4: Phospholipase D alpha 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55180`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0172400`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002141 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0009395 phospholipid catabolic process Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0045848 positive regulation of nitrogen utilization Biological Process

GO:0046470 phosphatidylcholine metabolic process Biological Process

GO:0048364 root development Biological Process

GO:0051301 cell division Biological Process

GO:0051365 cellular response to potassium ion starvation Biological Process

KEGG gene cross-reference

ath:AT1G55180

dosa:Os01g0172400

nta:107779725

rcu:8282326

zma:542702

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.622

Rank 1 · TkA01G479660 · TK1151

Nucleus0.258

Rank 2 · TkA01G479660 · TK1151

Cell membrane0.157

Rank 3 · TkA01G479660 · TK1151

Lysosome / Vacuole0.113

Rank 4 · TkA01G479660 · TK1151

Mitochondrion0.096

Rank 5 · TkA01G479660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168C238-105 aa

PF00614PLDc192-737 aa

PF13091PLDc_2227-323 aa

PF13091PLDc_2449-466 aa

PF00168C2594-620 aa

PF13091PLDc_2595-635 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G479660	`PF00168`	C2	38	105	0.0051	17.7
TkA01G479660	`PF00614`	PLDc	192	737	1.3e-188	628.6
TkA01G479660	`PF13091`	PLDc_2	227	323	8.3e-10	39.3
TkA01G479660	`PF13091`	PLDc_2	449	466	8.3e-10	39.3
TkA01G479660	`PF00168`	C2	594	620	0.0051	17.7
TkA01G479660	`PF13091`	PLDc_2	595	635	8.3e-10	39.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C888`	Arabidopsis thaliana	sp\|Q9C888\|PLDA4_ARATH Phospholipase D alpha 4	59.700%	Swiss-Prot	High
`Q43007`	Oryza sativa subsp. japonica	sp\|Q43007\|PLDA1_ORYSJ Phospholipase D alpha 1	43.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card