TkA01G475130 | RubberDandelionOmics

Gene overview

TkA01G475130

Reference: TK1151 Chr: Chr01 Coordinates: 118942289-118942915 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

627 bp · TkA01G475130|TK1151|cDNA

ATGATCCACATTCTCTTGCTCCTTTCTATCTTCACCTTCTCCGCCCATTCAGCAGTCCAAGACTTCTGTGTCGCAGATGTAAAAGGCCCTGAAAGCCCCGCCGGCTATTCTTGCAAACCAGCCACCATTGTCACCGTCGATGACTTTGTTTCCACCGGCCTTCGAGCTTCCGGAAACCTTTCCAACATCATCAAAGCTGCCGTCACTCCAGCATTTGCTGCCCAGCTCCCCGGAGTCAACGGTCTAGGGATCTCCATTGC...

CDS

Download CDS FASTA

627 bp · TkA01G475130|TK1151|CDS

ATGATCCACATTCTCTTGCTCCTTTCTATCTTCACCTTCTCCGCCCATTCAGCAGTCCAAGACTTCTGTGTCGCAGATGTAAAAGGCCCTGAAAGCCCCGCCGGCTATTCTTGCAAACCAGCCACCATTGTCACCGTCGATGACTTTGTTTCCACCGGCCTTCGAGCTTCCGGAAACCTTTCCAACATCATCAAAGCTGCCGTCACTCCAGCATTTGCTGCCCAGCTCCCCGGAGTCAACGGTCTAGGGATCTCCATTGC...

Protein

Download Protein FASTA

208 aa · TkA01G475130|TK1151|PROTEIN

MIHILLLLSIFTFSAHSAVQDFCVADVKGPESPAGYSCKPATIVTVDDFVSTGLRASGNLSNIIKAAVTPAFAAQLPGVNGLGISIARLDLAPGGVVPMHTHPGGSELLLVTQGFIKAGFISSANAVYVKTLQKGDLMVFPQGLLHFQVNAGGVTAVAFASFSSATPGLQILDFALFANDLPSSLVEATTFLDDATVKKLKAVLGGTG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G475130`
TK1151 ID	TkA01G475130
OH-1004 ID	LXL04_002191
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G475130

Location Chr01:118942289-118942915 (+)

Description Similar to ABP19A: Auxin-binding protein ABP19a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20630`	May play a role in plant defense.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002191 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009536 plastid Cellular Component

GO:0031012 extracellular matrix Cellular Component

GO:0048046 apoplast Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0010011 auxin binding Molecular Function

GO:0030145 manganese ion binding Molecular Function

GO:0030971 receptor tyrosine kinase binding Molecular Function

GO:0038198 auxin receptor activity Molecular Function

KEGG gene cross-reference

ath:AT5G20630

pper:18770577

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.744

Rank 1 · TkA01G475130 · TK1151

Lysosome / Vacuole0.067

Rank 2 · TkA01G475130 · TK1151

Endoplasmic reticulum0.064

Rank 3 · TkA01G475130 · TK1151

Cytoplasm0.055

Rank 4 · TkA01G475130 · TK1151

Cell membrane0.047

Rank 5 · TkA01G475130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00190Cupin_154-198 aa

PF07883Cupin_289-158 aa

PF12973Cupin_789-114 aa

PF19480DUF601691-123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G475130	`PF00190`	Cupin_1	54	198	9e-35	120.2
TkA01G475130	`PF07883`	Cupin_2	89	158	8.7e-07	29.3
TkA01G475130	`PF12973`	Cupin_7	89	114	0.19	12.3
TkA01G475130	`PF19480`	DUF6016	91	123	0.38	11.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P94072`	Arabidopsis thaliana	sp\|P94072\|GL33_ARATH Germin-like protein subfamily 3 member 3	68.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card