TkA01G468680 | RubberDandelionOmics

Gene overview

TkA01G468680

Reference: TK1151 Chr: Chr01 Coordinates: 117346091-117349266 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2507 bp · TkA01G468680|TK1151|cDNA

AAAGAGCAATCATTAGAAGTTGAGGGAAATTCTTTGGATCCTAGTTTAAGCAATGAAAGTGTGTTCTTGTTTATGAGTGTTTAGGTGTTCAACTTTGTGAGTGATTGTGTAATTTCTTGGTGGTGCTAATATACTATCTCTCTTGCTTGTTCGCCTGTGGACTAGCCGATGAAACTGCTCGGTGAACCACGTTAAATATTTGTGTGTCGATTATTTATCGTTTCAGTAGATGATTTTTCAGTTGTTTCTAACATCGTTTC...

CDS

Download CDS FASTA

1473 bp · TkA01G468680|TK1151|CDS

ATGCTTGTGAATTGGGAAAAACAGCAATCGATGAATACCTCGCCGTTTATGGACAAGCAGATCATGGATCTATCGAGTTCTCAAAATAAGAATAACGCAGAAAAAGATTTCATGGATCTGAACAATCAACCCCCTCAAGAGGACGAACAACATGACGTCGTTGTCGGCGATGATGATAAGAAGGATGAGATCCTACCTAGCTATGACTTCCAACCAATCCGCCCGATCACATCATCGCAGCCGTCGAATTTTGAATCAAG...

Protein

Download Protein FASTA

490 aa · TkA01G468680|TK1151|PROTEIN

MLVNWEKQQSMNTSPFMDKQIMDLSSSQNKNNAEKDFMDLNNQPPQEDEQHDVVVGDDDKKDEILPSYDFQPIRPITSSQPSNFESSSGSGARVWASAESKPNFGTRNYGSLDSVEPPKVTMEKDRSVIDAALISEIDRTMKKHADNLMYALEGVSARISQLESRSRNLENSVDDLRTYFGNSHGNTDGKLRQIENIIREVQAGIEVVKDKQEIMETQLQLSQVKFSKPEQPPEPHISGHMGSLQQQAALPSPPLPNPQN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G468680`
TK1151 ID	TkA01G468680
OH-1004 ID	LXL04_023952
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G468680`
Location	Chr01:117346091-117349266 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023952` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.554

Rank 1 · TkA01G468680 · TK1151

Nucleus0.368

Rank 2 · TkA01G468680 · TK1151

Endoplasmic reticulum0.112

Rank 3 · TkA01G468680 · TK1151

Cell membrane0.109

Rank 4 · TkA01G468680 · TK1151

Golgi apparatus0.102

Rank 5 · TkA01G468680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30917CCDC57_N135-220 aa

PF00038Filament139-221 aa

PF10473CENP-F_leu_zip140-174 aa

PF05791Bacillus_HBL142-221 aa

PF23991DUF7310144-182 aa

PF05565Sipho_Gp157147-180 aa

PF25014NET2A148-221 aa

PF14257DUF4349153-234 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G468680	`PF30917`	CCDC57_N	135	220	0.056	13.0
TkA01G468680	`PF00038`	Filament	139	221	0.31	11.4
TkA01G468680	`PF10473`	CENP-F_leu_zip	140	174	0.43	11.3
TkA01G468680	`PF05791`	Bacillus_HBL	142	221	0.14	12.7
TkA01G468680	`PF23991`	DUF7310	144	182	0.075	14.2
TkA01G468680	`PF05565`	Sipho_Gp157	147	180	0.018	15.7
TkA01G468680	`PF25014`	NET2A	148	221	0.65	10.5
TkA01G468680	`PF14257`	DUF4349	153	234	2.3e-05	24.6
TkA01G468680	`PF05911`	FPP	153	223	0.17	10.8
TkA01G468680	`PF23203`	KIF21A	165	231	0.45	11.0
TkA01G468680	`PF05565`	Sipho_Gp157	185	220	0.018	15.7
TkA01G468680	`PF10473`	CENP-F_leu_zip	190	224	0.43	11.3
TkA01G468680	`PF07223`	DUF1421	434	477	2.5e-20	72.8
TkA01G468680	`PF25014`	NET2A	434	461	0.65	10.5
TkA01G468680	`PF09288`	UBA_3	436	459	0.21	12.2
TkA01G468680	`PF00627`	UBA	437	452	0.086	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card