RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G463430
Reference: TK1151 Chr: Chr01 Coordinates: 116119097-116122326 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1119 bp · TkA01G463430|TK1151|cDNA

ATGCAGGTGGGTACAACTGGAGGAGGTGAGGCGTCTACCGGAAGGGATCATATAAGTGTGAGAGGTATCACGTGCGACGAGCATGACCTACAGCAACAGCATCACGTGACACATGAGAACCACCAACAACATCCACATCATCACCAGATGGCAGCGGCTGCTTTCCACGTCAGCAGACCAAGTCATCCTGTTTCCAATCTTGTTTCGCCACCTCCCCATCCACATCCCCTACATCACTCCTCCATTATGCTTGATGAGGA...

CDS

Download CDS FASTA

480 bp · TkA01G463430|TK1151|CDS

ATGCAGGTGGGTACAACTGGAGGAGGTGAGGCGTCTACCGGAAGGGATCATATAAGTGTGAGAGGTATCACGTGCGACGAGCATGACCTACAGCAACAGCATCACGTGACACATGAGAACCACCAACAACATCCACATCATCACCAGATGGCAGCGGCTGCTTTCCACGTCAGCAGACCAAGTCATCCTGTTTCCAATCTTGTTTCGCCACCTCCCCATCCACATCCCCTACATCACTCCTCCATTATGCTTGATGAGGA...

Protein

Download Protein FASTA

159 aa · TkA01G463430|TK1151|PROTEIN

MQVGTTGGGEASTGRDHISVRGITCDEHDLQQQHHVTHENHQQHPHHHQMAAAAFHVSRPSHPVSNLVSPPPHPHPLHHSSIMLDEDSYHVSRIMDNFQQHHHHKIGGRSTSGLEELIMGCTPTSSTDIKEESSITNHQETDWLKYSTFWPDPDSQDHH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G463430
TK1151 IDTkA01G463430
OH-1004 IDLXL04_002474
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)95.000
Protein coverage (%)TK1151 99.371 / OH-1004 34.632
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G463430
LocationChr01:116119097-116122326 (-)
DescriptionSimilar to NAC075: NAC domain-containing protein 75
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g29230 Transcription activator involved in xylem formation. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_002474 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000077 DNA damage checkpoint signaling Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0010321 regulation of vegetative phase change Biological Process
GO:0010332 response to gamma radiation Biological Process
GO:0040020 regulation of meiotic nuclear division Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:0071555 cell wall organization Biological Process
GO:1900057 positive regulation of leaf senescence Biological Process
GO:1903648 positive regulation of chlorophyll catabolic process Biological Process
GO:1905177 tracheary element differentiation Biological Process
GO:2000652 regulation of secondary cell wall biogenesis Biological Process
KEGG gene cross-reference
ath:AT1G25580
ath:AT1G28470
ath:AT3G04060
ath:AT4G28500
ath:AT4G29230
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.958
Rank 1 · TkA01G463430 · TK1151
Cytoplasm0.200
Rank 2 · TkA01G463430 · TK1151
Mitochondrion0.020
Rank 3 · TkA01G463430 · TK1151
Cell membrane0.016
Rank 4 · TkA01G463430 · TK1151
Lysosome / Vacuole0.009
Rank 5 · TkA01G463430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9M0F8Arabidopsis thalianasp|Q9M0F8|NAC75_ARATH NAC domain-containing protein 7550.800%Swiss-ProtMedium

JBrowse

View in Genome Browser