TkA01G461130 | RubberDandelionOmics

Gene overview

TkA01G461130

Reference: TK1151 Chr: Chr01 Coordinates: 115550317-115556234 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3881 bp · TkA01G461130|TK1151|cDNA

ACAAATTAGACTACTTTCTAGTCTATTTAAGGGGCACTTTTGAATATGAAGTTTTCTTGCAAGCAGGTTTACAAAACCCTCTCCGAGCAGGAGCTTTCACCCAAGCCCGCGAGACACTGTTGCTGGCGATCATATCTTCGTAGAACATTAAACATAGTTATACAGTGTAGATTATTACATATTTCTTCGTTTTTTGGAATGGTAGATTTTTCAACTGAAGTACCTCTGCAACCTTCGGTCGAGGGGTTGATCAATAAGAT...

CDS

Download CDS FASTA

3630 bp · TkA01G461130|TK1151|CDS

ATGAAGTTTTCTTGCAAGCAGGTTTACAAAACCCTCTCCGAGCAGGAGCTTTCACCCAAGCCCGCGAGACACTGTTGCTGGCGATCATATCTTCGTAGAACATTAAACATAGTTATACAGTGTAGATTATTACATATTTCTTCGTTTTTTGGAATGGTAGATTTTTCAACTGAAGTACCTCTGCAACCTTCGGTCGAGGGGTTGATCAATAAGATATGCGTAGAGAAAGGCATAACGCCTCCAGATGTTTCCTCCCGGCG...

Protein

Download Protein FASTA

1209 aa · TkA01G461130|TK1151|PROTEIN

MKFSCKQVYKTLSEQELSPKPARHCCWRSYLRRTLNIVIQCRLLHISSFFGMVDFSTEVPLQPSVEGLINKICVEKGITPPDVSSRRILSTITEASAIEILNKIAVSSNIRTFSGFIVHLVKQNSAVVSSPNGIRGSPQKQSLSPSSAAGTPNKYLSPNSKPFADSPFSSSKATTITQYFPRSPHDDSSSSLSKQITYSKDANPNTTATYHLTESSRANHIVSAQKQLTFSPCSSLKEANPSNANGLVSQVHKRLAFSPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G461130`
TK1151 ID	TkA01G461130
OH-1004 ID	LXL04_019033
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	49.900
Protein coverage (%)	TK1151 94.955 / OH-1004 99.167 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G461130

Location Chr01:115550317-115556234 (-)

Description Similar to RDR3: Probable RNA-dependent RNA polymerase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19910`	Probably involved in the RNA silencing pathway and required for the generation of small interfering RNAs (siRNAs).	No verified direct reference in this release
`At2g19930`	Probably involved in the RNA silencing pathway and required for the generation of small interfering RNAs (siRNAs).	No verified direct reference in this release
`At2g19920`	Probably involved in the RNA silencing pathway and required for the generation of small interfering RNAs (siRNAs).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0197900`	Probably involved in the RNA silencing pathway and required for the generation of small interfering RNAs (siRNAs).	No verified direct reference in this release
`Os01g0198000`	Probably involved in the RNA silencing pathway and required for the generation of small interfering RNAs (siRNAs).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019033 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0030422 siRNA processing Biological Process

GO:0009507 chloroplast Cellular Component

GO:0031380 nuclear RNA-directed RNA polymerase complex Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003968 RNA-directed RNA polymerase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19910

ath:AT2G19920

ath:AT2G19930

dosa:Os01g0197900

dosa:Os01g0198000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.841

Rank 1 · TkA01G461130 · TK1151

Cytoplasm0.169

Rank 2 · TkA01G461130 · TK1151

Cell membrane0.045

Rank 3 · TkA01G461130 · TK1151

Mitochondrion0.026

Rank 4 · TkA01G461130 · TK1151

Endoplasmic reticulum0.024

Rank 5 · TkA01G461130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF262494HB_RdRP3_N58-130 aa

PF26252RdRP_helical350-415 aa

PF05183RdRP435-1065 aa

PF24453DUF7569577-597 aa

PF24453DUF75691097-1127 aa

PF26253RdRP_head1111-1189 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G461130	`PF26249`	4HB_RdRP3_N	58	130	5.3e-10	40.1
TkA01G461130	`PF26252`	RdRP_helical	350	415	2.9e-08	34.4
TkA01G461130	`PF05183`	RdRP	435	1065	8.2e-105	352.4
TkA01G461130	`PF24453`	DUF7569	577	597	0.42	11.4
TkA01G461130	`PF24453`	DUF7569	1097	1127	0.42	11.4
TkA01G461130	`PF26253`	RdRP_head	1111	1189	3.5e-13	50.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82190`	Arabidopsis thaliana	sp\|O82190\|RDR3_ARATH Probable RNA-dependent RNA polymerase 3	45.900%	Swiss-Prot	Medium
`O82188`	Arabidopsis thaliana	sp\|O82188\|RDR5_ARATH Probable RNA-dependent RNA polymerase 5	46.600%	Swiss-Prot	Medium
`O82189`	Arabidopsis thaliana	sp\|O82189\|RDR4_ARATH Probable RNA-dependent RNA polymerase 4	45.400%	Swiss-Prot	Medium
`Q5QMN5`	Oryza sativa subsp. japonica	sp\|Q5QMN5\|RDR3_ORYSJ Probable RNA-dependent RNA polymerase 3	39.000%	Swiss-Prot	Medium
`Q5QMN4`	Oryza sativa subsp. japonica	sp\|Q5QMN4\|RDR4_ORYSJ Probable RNA-dependent RNA polymerase 4	44.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card